|
|
|
|
Primo MSP 3.2 Help: Methylation Specific PCR Primer Design
About Primo MSP 3.2: Online
Primo MSP 3.2 is for methylation specific PCR (MSP) primer design.
To use the program, copy and paste your CpG island sequence into the input
window and click on go.
For normal PCR primer design, please use
Primo Pro 3.2 which
reduces PCR noise by lowering the probability of random primering. As a result of reduced random priming,
we expect improved amplification efficiency and cleaner products, especially for RT-PCR.
Both Primo MSP and Primo Pro 3.2 have a batch mode option for high throughput
PCR primer design. By selecting the batch mode, users can input
multiple sequences and design PCR primers for multiple sequences.
|
Behind the scene:
1. Code for Degenerate OligosA A C C G G T T U T M (AC) R (AG) W (AT) S (CG) Y (CT) K (GT) V (ACG) H (ACT) D (AGT) B (CGT) N (ACGT)Any other letters will be ignored, so you can paste in a nucleotide sequences with spaces and numbers.
2. Melting temperature and annealing temperature Melting temperature is the temperature at which 50% of the oligo and its perfect complement are in duplex. PCR annealing temperature a few degree (4-6) lower than the melting temperature is usually used to increase the probability of primer binding. There are two options for calculating the melting temperature. The first uses the simple rule of 2 degree for each A or T and 4 degree for each C or G.
Melting temperature = 4 * Number of G or C + 2 * Number of A or T.
The second "Nearest N" predicts melting temperature using the "Nearest Neighbor" model (Jhon SantaLucia, Proc. Natl. Acad. Sci. Vol. 95, p1460-1465 (1998)). The cation concentration is assumed to be 50 mM and the primer concentration is assumed to be 200 nanomolar. The "Nearest N" is presented because it is more accurate and other formulae can be viewed as approximations of the "Nearest N".
The "Nearest N" formula has a correction for primer concentration. If lower or higher primer concentration is used, the rule-of-thumb is that for each two fold increase or decrease in the primer concentration, the melting temperature should increase or decrease by 1 degree. (Click here to see the relationship between primer concentration and melting temperature.)
For degenerate primers, the effective concentration is lower because of degeneracy. Users don't need to adjust for the lowered effective concentration if using the "Nearest N" formula, Primo has already taken that into account. Users are suggested to select the "Nearest N" formula if template sequences consist of degenerate codes.
To compare melting temperatures calculated using the two formulae, type or copy the primer sequence into the "2nd primer" field, and mouse-click on the text field. The melting temperature will be calculated using the selected formula. Click here to see the melting temperatures calculated using both formulae for some commonly used PCR and sequencing primers.
For degenerate nucleotides, an average is used.
3. Primer-primer dimer
If you select to "Check primer-primer dimers", Primo eliminates primers
that might form primer-primer dimers such as the following:
P1: 5'-...GGCGATCG-3'
||||||
3'-GCTAGCGG...-5' : P1 or
P1: 5'....AGGGCCC-3'
|| |
3'-CGCGAAT...-5' : P2
The following single-base pair is also not allowed:
P1: 5'-...AGGTCGCG-3'
|
3'-CGGATT...5' : P2
4. Methylated and un-methylated primers
In MSP, genomic DNA is modified by treatment with bisulfite
(sodium bisulfite), which converts all unmethylated cytosines to
uracil and then to thymidine during the subsequent PCR step.
If the CpGs are methylated, all non-CpG cytosines will be converted
to T. If the CpGs are not methylated, all cytosines will be converted
to T.
Methylated primers recognize the converted sequence where CpG remain unchanged. Unmethylated primers pairs with the template where every cytosines have been converted to thymidine.
At least one CpG must be present in the MSP primer and CpG at the 3'-end of the primer is preferred.
Batch mode
To use the batch mode, select the batch mode checkbox and input multiple sequences in the following format:>seq1 0-100 -100-0 catctccgagaggaaggcgaactcgaggagagcgatccggagcagcatggagtcctctgcagata gactagccagggccagcggccctgggccgtgagcacgaggtgcgggcactgctggaagccggggc ttcaccaaacgccccgaacactttcggtcgtaccccgatacaggt >seq2 GCTTGAGCCCAGGAGTTCGAGGCTGCAGTGAGCTGTGATCGCACCACTGCACTCCAGCTT GGGTGAAAGAGTGAGCCCCATCTCCAAAACGAACAAACAAAAAATCCCAAAAAACAAAAG AACTCAGCCAAGTGTAAAAGCCCTTTCTGATCCCAGGTCTTAGTGAGCCACCGGCGGGGC TGGGATTCGAACCCAGTGGAATCAGAACCGTGCAGGTCCCATAACCCACCTAGACCCTAG CAACTCCAGGCTAGAGGGTCACCGCGTCTATGCGAGGCCGGGTGGGCGGGCCGTCAGCTC
Each sequence starts with an info line with a > sign. The description of the sequence may be followed by the optional 5' and 3' range for forward or reverse primers. The three fields are separated by "tab."
If the range value starts with a minus sign, then the counting will be from the 3'-end of the sequence. If both ranges are missing in the info line, the input value from the Primo interface will be used. If only one range is present in the info line, that value will be used for designing forward or reverse primer only. It will be ignored for selecting pairs of forward and reverse primers.