Online
|
Download
|
Store
|
Contact
|
About

BioToolKit 300
Order BioToolKit 300 Download BioToolKit 300
(Demo full-functional. Supports PC and Mac.)
Order BioToolKit 300 today, get a Free USB flash disk.

BioToolKit 300

 BioToolKit is a collection of tools frequently used by bench biomedical scientists. It is designed by bench scientists and easy to use. Functions include:

Primo PCR Primer Design

  • Primo Pro Standard PCR, reduces primer dimer and random primering. Batch mode.
  • Primo Multiplex Multipe PCR in one tube. Reduces dimers and random primering.
  • Primo Degenerate Degenerate primers based on single protein, or multiple alignments of proteins or nucleotides
  • Primo Diverse Single pair of primers to amplify regions that are most diverse in a gene family
  • Primo Unique Multiple primer pairs, each uniquely amplify one gene in a family
  • Primo MSP Methylation-specific PCR primers
  • Primo Profile Design degenerate primers to profile large number of genes
  • Primo Random Generates random primers for RAPD, AP-PCR, and RAP-PCR.
  • Primo Optimum Design primers for optimizing gene expression
  • Primo Melt Primer design for DGGE or TGGT.

    Abie Peptide Antibody Design

     Abie Pro 3.0 designs antigenic peptide with reduced background antibody cross-reactions. Proteomes of each species has a unique pattern of over-represented short amino acid sequences. For example, GSGS is present in the mouse proteome for thousands of times and in thousands of proteins. These over-represented sequences cause problems for peptide antibody design. If present in a peptide used for raising an antibody, they may induce an antibody that cross-reacts with a large number of unwanted proteins. By selecting a peptide with few over-represented sequences, a user will have a better success rate in raising an antibody with low background. In addition Abie has a number of cool features.

    Centrifugation speed/force conversion

     Converts between relative centrifugation force (RCF, g) and centrifugation speed (RPM, resolution per minute). To convert, select a rotor and then click on "<=>". To save the parameters for a new rotor, type the rotor name in the rotor name field and click on save.

    Molecular weight calculation for oligos, peptides, and chemicals

    For chemicals, the composition should be in the following form: CaCl2 indicates 1 Ca and 2 Cl. (CHO)6 indicates 6 C, 6 H, and 6 O. If a composition is not recognized, no calculation will be made. Note the element names are case-sensitive, i.e., a lower case c will not be recognized as C or CL will not be recognized as Cl.
    For DNA/RNA, degenerate codes are accepted. In the case of degenerate codes, the average molecular weight will be calculated. For protein, the program reads sequences in the single-letter codes.

    Molar concentration calculator

    This is a friendly calculator for calculations related to molar concentrations.

    Spectrometer measurement for DNA and protein concentration

     The parameters are preset for oligos and peptides. You may input your own parameters for specific proteins, chemicals, or measurements using wavelengths other than UV. Simply type in a new measurement type name, and fill in the parameters, and click on save.

    Stock recipe calculator

     Comes with recipes of tens of commonly used stock solutions. Input a total volume, the program computes for you the amount of each ingredient needed.

    Units conversion

     Units conversion in 14 categories (length, volume, temperature, radioactivity, etc.).

    Master cocktail mix calculator

     For multiple reactions, one frequently makes a master mix of reagents and aliquot to individual tubes or wells. Master mix calculator calculates the amount of reagents you need.

    Clinical calculator

     1. For time date conversion, the Gregorian Calendar is used. So it will not be accurate for dates before the Gregorian Calendar is introduced.
    2. Body Mass Index (BMI) = Weight (kg) / Height (m)2. The "normal" range is 20-25.
    3. Body Surface Area (BSA) = 0.20247 x Height(m)0.725 x Weight(kg)0.425.

    Grade Book

     GradeBook 1.02 provides the following functions:
    1. Calculates final grades from exam and homework scores. Setup allows varying weights for each score and discarding lowest scores.
    2. Converts number scores to letter scores.
    3. Save files in HTML format for display on the web or printing. Setup allows hiding names and displaying partial student IDs.
    Usage:
    1. Input Input label files should be Tab delimited text files with column names in the first line. If you edit using Excel spreadsheet, you could simply save it as a "tab-delimited" text file. Column names must be unique.
    2. Calculator To use the "Calculator", one of your column names must be "overall", "overall score", or "overall grade". The final calculated score will be saved in this column. To convert to letter grades, check the "convert to letter grade" checkbox, and a conversion table will appear below. You can change the percentiles and their corresponding letter grades. The Score Range will be calculated automatically from Percentile and the Score Range will then be used to calculate the final letter grade (since several students can have the same number grade, using Percentile may randomly give some higher and others lower scores).
    3. HTML setup You can select to display only a subset of columns in your HTML page. If you need to display only partial student ID, the id column must have the column name "ID", or "Student ID". To print, open the HTML page with a web browser (e.g., Internet Explorer or Netscape), and print the web page.

    Label printing

     LabLabel 1.02 is a label printing software. In addition in printing conventional address, stock, and package labels, it can add barcodes to your labels. If your research is moving in the direction of high through-put, bar-coding your reagents and data could result in enormous savings in time and money.
    Usage:
    1. Input label files should have either one of the following formats: (1) Tab delimited text files with individual labels in separate lines: If you edit your label information in Excel spreadsheet, you might want to save it as a "tab-delimited" text file. Each label will be in one line and each field will then be printed in a separated line. For example, the following stock label 
      5xTBA	Date: 3/21/2002	By: Eric Heller
    will be printed as
                5xTBA
            Date: 3/21/2002
            By: Eric Heller

    (2) Text files with labels separated by blank lines: The software will print the following in two labels: 
       		Name: P345
   		Sequence: ATCGGGTGTNNNCGCAGCGACC
   		Date: 2/11/2001
   		Scale: 40 nmol
   		Direction: forward

   		Name: P347
   		Sequence: TTTCGAGGCCAGCGTGCACC
   		Date: 2/11/2001
   		Scale: 40 nmol
   		Direction: reverse

    2. Barcodes: To include barcodes, check the Barcode checkbox on the toolbar menu. A randomly generated barcode will be included at the end of each label if you don't specify where or the code string. To insert barcode in the middle of a label, simply mark it with the word "barcode". 
       		Name: P347
   		Sequence: TTTCGAGGCCAGCGTGCACC
   		barcode
   		Date: 2/11/2001
   		Scale: 40 nmol
   		Direction: reverse
    The above label will print a random barcode between "Sequence" and "Date" lines. To add a specific barcode, include the barcode string you want. 
       		Name: P347
   		Sequence: TTTCGAGGCCAGCGTGCACC
   		barcode TTTCGAGG
   		Date: 2/11/2001
   		Scale: 40 nmol
   		Direction: reverse
    The above label will print a barcode encoded by the first 8 nucleotide sequence of the primer.
    3. Barcode styles: Code 39 and Code 128 are both alphanumeric barcodes of variable lengths. They are often the choices for internal tracking. Codebar is frequently used in blood banks. UPC is the industry standard code for retail products. Contact us if you need other styles. For details, go to http://www.barcodehq.com/primer.html.
    4. Label styles: LabLabel 1.02 prints on 8.5x11 (A4) papers. Styles range from 80 labels per sheet (4x20) to 1 label per sheet (1x1). These styles are compatible with Avery label products. For details of supported Avery products, go to http://www.changbioscience.com/lablabel/index.html.
    5. Preview will display the first page. Mouse-click will lead to additional pages if available.

    Microarray and High-Throughtput Data Analysis
  • MicroHelper 1.02 Merge datasets, check data integrity, filter noises, and normalize data.
  • Godlist Manager 1.0 Batch retrieve of gene information and sequences, and generate links to virtually all bioinformatics databases.
  • Heatmap Viewer 1.2 Heatmap, which uses a gradient of colors to represent data values, has been successfully used to present microarray data. The stand-only version of Heatmap Viewer 1.2 is designed to view any high throughput data including microarray data. The heatmap image can be saved as a JPEG file for including in other documents.

    Databases
  • PrimerBase 1.2 PrimerBase is a small and practical database for storing, searching, and designing of oligo-nucleotides. Searches by keywords and by sequences.
  • PeptideBase 1.4 Similar to PrimerBase, this software allows users to store peptide information into a searchable database. Searches by keywords and by sequences.

    Statistics
  • BioDataFit 1.02: Data fitting for dose-response, ligand-binding, enzyme kinetics, and growth inhibition. EC50 calculation using four-parameter or sigmoidal model.
  • Chi-square: Chi-square test.
  • Correlation: Linear and non-linear correlation coefficients.
  • Probability: Poisson and Binomial probability distribution.
  • SVM Classifier: Train to classify multiple classes.
  • SVM SeqClassifier: Train to recognize sequence patterns.
  • Sample Size: Estimate sample sizes needed.
  • t-test: t-test calculator. Y
  • z-test: z-test, normal distribution calculator.

    Suggestions and Bug Reports

     Thanks for using BioToolKit 300. Please let us know if you feel there can be additional improvements in the software. Send your comments, suggestions, and bugs to info@changbioscience.com. We will try our best to serve your needs in the next release of BioToolKit.
    • Copyright © 2002-2004 Chang Bioscience Inc. All rights reserved.