Online
|
Download
|
Store
|
Contact
|
About

Primo MSP 3.2 Help: Methylation Specific PCR Primer Design

About Primo MSP 3.2: Online

Primo MSP 3.2 is for methylation specific PCR (MSP) primer design. To use the program, copy and paste your CpG island sequence into the input window and click on go.

For normal PCR primer design, please use Primo Pro 3.2 which reduces PCR noise by lowering the probability of random primering. As a result of reduced random priming, we expect improved amplification efficiency and cleaner products, especially for RT-PCR.

Both Primo MSP and Primo Pro 3.2 have a batch mode option for high throughput PCR primer design. By selecting the batch mode, users can input multiple sequences and design PCR primers for multiple sequences.

Browser requirements:

Primo Pro 3.2 Online and Primo MSP 3.2 Online runs on the following Java-enabled browser:
  • PC: Internet Explorer 5.5 or higher and Netscape 4.08 or higher.
  • Mac (OS 9.*): Internet Explorer 5.0
  • Mac (OSX10): Early version of OSX10 IE5.1 has a bug. Copy and paste will kill the browser. The bug should have been fixed in later versions of Mac IE.

    If you use one of the above browser and you can't run Primo online, please make sure Java is enabled in your browser. For Internet Explorer, go to Tools/Internet Options, click on Security Settings, scroll down to find Microsoft VM, deselect "Disable Java". Mac OSX 10 IE5.1 has a bug, it does not allow copy/paste into a Java text field, thus you will not be able to import a new sequence. Attempting copy/paste may kill your browser. Stand-alone verisons of Primo, BioToolKit 180 and PrimerBase 1.2 don't require IE to run, thus don't have this problem.

    How to use:

    To start using Primo MSP, cut and copy your sequences into the input window. Numbers and white spaces will be ignored.
  • Behind the scene:

    1. Code for Degenerate Oligos
    A A 		C C
    G G 		T T
    U T 		M (AC)
    R (AG) 		W (AT)
    S (CG) 		Y (CT)
    K (GT) 		V (ACG)
    H (ACT) 	D (AGT)
    B (CGT) 	N (ACGT)
    
    Any other letters will be ignored, so you can paste in a nucleotide sequences with spaces and numbers.

    2. Melting temperature and annealing temperature Melting temperature is the temperature at which 50% of the oligo and its perfect complement are in duplex. PCR annealing temperature a few degree (4-6) lower than the melting temperature is usually used to increase the probability of primer binding. There are two options for calculating the melting temperature. The first uses the simple rule of 2 degree for each A or T and 4 degree for each C or G.

       Melting temperature = 4 * Number of G or C + 2 * Number of A or T.

    The second "Nearest N" predicts melting temperature using the "Nearest Neighbor" model (Jhon SantaLucia, Proc. Natl. Acad. Sci. Vol. 95, p1460-1465 (1998)). The cation concentration is assumed to be 50 mM and the primer concentration is assumed to be 200 nanomolar. The "Nearest N" is presented because it is more accurate and other formulae can be viewed as approximations of the "Nearest N".

    The "Nearest N" formula has a correction for primer concentration. If lower or higher primer concentration is used, the rule-of-thumb is that for each two fold increase or decrease in the primer concentration, the melting temperature should increase or decrease by 1 degree. (Click here to see the relationship between primer concentration and melting temperature.)

    For degenerate primers, the effective concentration is lower because of degeneracy. Users don't need to adjust for the lowered effective concentration if using the "Nearest N" formula, Primo has already taken that into account. Users are suggested to select the "Nearest N" formula if template sequences consist of degenerate codes.

    To compare melting temperatures calculated using the two formulae, type or copy the primer sequence into the "2nd primer" field, and mouse-click on the text field. The melting temperature will be calculated using the selected formula. Click here to see the melting temperatures calculated using both formulae for some commonly used PCR and sequencing primers.

    For degenerate nucleotides, an average is used.

    3. Primer-primer dimer
    If you select to "Check primer-primer dimers", Primo eliminates primers that might form primer-primer dimers such as the following:

    P1: 5'-...GGCGATCG-3'
                ||||||
             3'-GCTAGCGG...-5' : P1 
    or
    P1: 5'....AGGGCCC-3'
                 || |
              3'-CGCGAAT...-5' : P2 
    The following single-base pair is also not allowed:
    P1: 5'-...AGGTCGCG-3'
                     |
                  3'-CGGATT...5' : P2 

    4. Methylated and un-methylated primers
    In MSP, genomic DNA is modified by treatment with bisulfite (sodium bisulfite), which converts all unmethylated cytosines to uracil and then to thymidine during the subsequent PCR step. If the CpGs are methylated, all non-CpG cytosines will be converted to T. If the CpGs are not methylated, all cytosines will be converted to T.

    Methylated primers recognize the converted sequence where CpG remain unchanged. Unmethylated primers pairs with the template where every cytosines have been converted to thymidine.

    At least one CpG must be present in the MSP primer and CpG at the 3'-end of the primer is preferred.

    Batch mode

    To use the batch mode, select the batch mode checkbox and input multiple sequences in the following format:
    >seq1	0-100	-100-0
    catctccgagaggaaggcgaactcgaggagagcgatccggagcagcatggagtcctctgcagata
    gactagccagggccagcggccctgggccgtgagcacgaggtgcgggcactgctggaagccggggc
    ttcaccaaacgccccgaacactttcggtcgtaccccgatacaggt
    
    >seq2
    GCTTGAGCCCAGGAGTTCGAGGCTGCAGTGAGCTGTGATCGCACCACTGCACTCCAGCTT
    GGGTGAAAGAGTGAGCCCCATCTCCAAAACGAACAAACAAAAAATCCCAAAAAACAAAAG
    AACTCAGCCAAGTGTAAAAGCCCTTTCTGATCCCAGGTCTTAGTGAGCCACCGGCGGGGC
    TGGGATTCGAACCCAGTGGAATCAGAACCGTGCAGGTCCCATAACCCACCTAGACCCTAG
    CAACTCCAGGCTAGAGGGTCACCGCGTCTATGCGAGGCCGGGTGGGCGGGCCGTCAGCTC
    
    

    Each sequence starts with an info line with a > sign. The description of the sequence may be followed by the optional 5' and 3' range for forward or reverse primers. The three fields are separated by "tab."

    If the range value starts with a minus sign, then the counting will be from the 3'-end of the sequence. If both ranges are missing in the info line, the input value from the Primo interface will be used. If only one range is present in the info line, that value will be used for designing forward or reverse primer only. It will be ignored for selecting pairs of forward and reverse primers.

    Home Products Order Contact

    Copyright 2002-2004 Chang Bioscience, Inc. All rights reserved.