Homo sapiens

Number of sequences: 1354

Consensus	c/g	c/g/a	g/c	c/g/t	c/g/a	c/g/a	g/c/a	c/g/t	c/g/t	g/c/a	c/g	c/a/g	a/g	c/a	c/g	a	t	g	g/a	c/a	g/c/t	g/c/a	c/a/t	c/g	g/c/a	c/a/t/g
	a	19	22	19	19	21	22	21	18	18	21	16	23	51	30	18	99	0	0	23	28	15	22	28	16	25	26
	c	32	32	30	30	32	31	27	32	31	22	34	42	8	40	47	0	0	0	13	38	24	27	31	33	26	27
	g	29	26	32	29	27	27	34	27	28	39	29	23	34	16	26	0	0	99	47	18	37	34	17	31	31	20
	t	19	18	18	21	18	18	16	21	21	16	19	10	4	12	8	0	99	0	15	14	23	16	22	19	16	24

agcggcggcgggaagatgaggcttcg	U10474	Human clone GTN6 beta-1,4-galactosyltransferase mRNA, partial cds.
acagcagttccaaccctggaatcaac	U10485	Human lymphoid-restricted membrane protein (Jaw1) mRNA, complete
tttctggactcaacgatgactctgaa	U10550	Human Gem GTPase (gem) mRNA, complete cds.
catcggggtgggggcatggaatccgc	U10554	Homo sapiens vesicular acetylcholine transporter gene, complete
gtccccagggccgcgatgagcttcct	U10564	Human CDK tyrosine 15-kinase WEE1Hu (Wee1Hu) mRNA, complete cds.
gtagacagatacaagatgaaatcctg	Z92846	Human DNA sequence from clone LL0XNC01-105G4 on chromosome X
ctgatcagagtcatcatgcctcgagc	U10685	Human MAGE-10 antigen (MAGE10) gene, complete cds.
ctaaccagagtcatcatgcctcttga	U10686	Human MAGE-11 antigen (MAGE11) gene, complete cds.
ctgaccagagtcatcatgtcttctga	U10687	Human MAGE-4a antigen (MAGE4a) gene, complete cds.
ctgagcagagtcatcatgtcttctga	U10688	Human MAGE-4b antigen (MAGE4b) gene, complete cds.
gtgaccagagtcgtcatgtctcttga	U10689	Human MAGE-5a antigen (MAGE5a) gene, complete cds.
gtgaccagagtcgtcatgtctcttga	U10690	Human MAGE-5b antigen (MAGE5b) gene, complete cds.
ctgaccagagtcatcatgcctcttga	U10691	Human MAGE-6 antigen (MAGE6) gene, complete cds.
ggcgtccttgttccaatgggaaggtg	U10692	Human MAGE-7 antigen (MAGE7) pseudogene, complete cds.
ctgacctgagtcatcatgcttcttgg	U10693	Human MAGE-8 antigen (MAGE8) gene, complete cds.
ctgaccagagtcatcatgtctctcga	U10694	Human MAGE-9 antigen (MAGE9) gene, complete cds.
ccggccctggccccgatggctctgtg	U10860	Human guanosine 5'-monophosphate synthase mRNA, complete cds.
tggcagagcctcaggatggaccccct	U10868	Human aldehyde dehydrogenase ALDH7 mRNA, complete cds.
cagggcgcgcggggcatgaagccggc	U10886	Human density enhanced phosphatase-1 mRNA, complete cds.
ccagaatccgtgaacatggcgaacga	U10902	Human alcohol dehydrogenase 5 (ADH5) gene, 5' region and exon 1,
ccggaatctccagggatgaccagccc	U10990	Human nuclear receptor hTAK1 (hTAK1) mRNA, complete cds.
gacaccccggccagaatggagctgac	U11025	Human megakaryocyte growth and development factor (MGDF) mRNA,
ggcgactggccggccatgccttcccg	U11050	Human NIMA-like protein kinase 1 (NLK1) mRNA, complete cds.
gtccacgagcccaagatggatgcgct	U11058	Homo sapiens large conductance calcium- and voltage-dependent
tggattggagacaagatgggatcctc	U11090	Human hydroxyindole-O-methyltransferase promoter A-derived (HIOMT)
tggattggagacaagatgggatcctc	U11091	Human hydroxyindole-O-methyltransferase promoter B-derived (HIOMT)
ggaagattagcggccatgtattccaa	U11270	Human antithrombin III gene, exon 1 and partial cds.
cagggctccggagccatgtggcccaa	U11271	Human alternatively spliced endothelial thromboxane A2 receptor
cttcctctgtctgccatggaccaaca	U11276	Human hNKR-P1a protein (NKR-P1A) mRNA, complete cds.
cctgggagactgtggatgaataatgc	U11282	Human alpha(1,3)fucosyltransferase mRNA, complete cds.
gtcgacgagttgaagatgaagcccag	U11287	Human N-methyl-D-aspartate receptor subunit NR3 (hNR3) mRNA,
cggcccggcccggccatggcctcgtt	U11292	Homo sapiens Ki nuclear autoantigen mRNA, complete cds.
acagctggacgggcaatggcgggtcg	U11293	Human Rab5c-like protein mRNA, complete cds.
ggtgtctatgaaactatggatggtac	U11424	Human thiopurine methyltransferase processed pseudogene
cacaccgacggtaccatgaaggacga	U11552	Human leukotriene-C4 synthase mRNA, complete cds.
gcccaggcccggaccatgcatggcca	U11690	Human faciogenital dysplasia (FGD1) mRNA, complete cds.
tgtccgtgcgggacgatgcctgagca	U11700	Human copper transporting ATPase mRNA, complete cds.
ccgcgtcccgccgcgatgctgttcca	U11701	Human LIM-homeobox domain protein (hLH-2) mRNA, complete cds.
ggcagcagtcttagaatgagtagcaa	U11717	Human calcium activated potassium channel (hslo) mRNA, complete
ctctcgctgtgagacatgtctgagac	U11732	Human ets-like gene (tel) mRNA, complete cds.
ggtcacgattccataatgtaccacaa	U11791	Human cyclin H mRNA, complete cds.
attggtaccgtaaccatggtcagctg	U11814	Human soluble keratinocyte growth factor receptor mRNA,
gactcaccagctgccatgcagcagcc	U11821	Human Fas ligand (FasL) mRNA, complete cds.
atctgtggaaggagaatgcctaaagt	U11861	Human G10 homolog (edg-2) mRNA, complete cds.
gccgtggagcgagagatgccggccct	U11862	Human clone HP-DAO1 diamine oxidase, copper/topa quinone-containing
gccgtggagcgagagatgccggccct	U11863	Human clone HP-DAO2 diamine oxidase, copper/topa quinone containing
gaaactgaagaggacatgtcaaatat	U11870	Human interleukin-8 receptor type A (IL8RBA) gene, promoter and
gaaactgaagaggacatgtcaaatat	U11871	Human interleukin-8 receptor type A (IL8RA) mRNA, partial cds.
aagtttacctcaaaaatggaagattt	U11872	Human interleukin-8 receptor type B (IL8RB) mRNA, splice variant
aagtttacctcaaaaatggaagattt	U11873	Human interleukin-8 receptor type B (IL8RB) mRNA, splice variant
aagtttacctcaaaaatggaagattt	U11874	Human interleukin-8 receptor type B (IL8RB) mRNA, splice variant
aagtttacctcaaaaatggaagattt	U11875	Human interleukin-8 receptor type B (IL8RB) mRNA, splice variant
aagtttacctcaaaaatggaagattt	U11876	Human interleukin-8 receptor type B (IL8RB) mRNA, splice variant
aagtttacctcaaaaatggaagattt	U11877	Human interleukin-8 receptor type B (IL8RB) mRNA, splice variant
aagtttacctcaaaaatggaagattt	U11878	Human interleukin-8 receptor type B (IL8RB) mRNA, splice variant
tctttctggggtaatatgcacgtgtc	U12128	Human protein tyrosine phosphatase 1E (PTP1E) mRNA, complete cds.
tcaaccagaatcaagatgtctgggac	U12134	Human DNA damage repair and recombination protein RAD52 mRNA,
cactggctgctagggatgtcgtcctg	U12140	Human tyrosine kinase receptor p145TRK-B (TRK-B) mRNA, complete
acaagcgagaggatcatggcggatgg	U12170	Human zinc finger homeodomain protein mRNA, complete cds.
agatagatcgccatcatggtgagtct	U12202	Human ribosomal protein S24 (rps24) gene, complete cds.
cacttgccaacatagatggaaccggc	U12206	Human clone pL713 hypothetical protein mRNA, partial cds.
ggtcgtcctctcagcatgggggtccc	U12255	Human IgG Fc receptor hFcRn mRNA, complete cds.
ggtgtctctgaaactatggatggtac	U12387	Human thiopurine methyltransferase (TPMT) mRNA, complete cds.
gcggcgtgagaagccatgagcagcaa	U12404	Human Csa-19 mRNA, complete cds.
gcagctgcagcagccatggccccgcc	U12421	Human mitochondrial benzodiazepine receptor (MBR) gene, complete
atctcaggctaagaaatggcatttca	U12424	Human mitochondrial glycerol-3-phosphate dehydrogenase mRNA,
aaggtaattgctgccatggaaacaca	U12431	Human ELAV-like neuronal protein 1 (hel-N1) mRNA, complete cds.
gcggcttgtgcagcaatggccaagat	U12465	Human ribosomal protein L35 mRNA, complete cds.
gcagtcttcgccaccagtgagtacgc	U12472	Human glutathione S-transferase (GST phi) gene, complete cds.
tccccagcagaagcgatgggcagtgt	U12507	Human cardiac inward rectifier potassium channel (HH-IRK1) mRNA,
caagtgaaagacacaatgaatggtca	U12535	Human epidermal growth factor receptor kinase substrate (Eps8)
ttgctttttccagccatgaatgcttc	U12541	Human ROM-K potassium channel protein isoform romk1 mRNA, complete
gtgttgacagaaagtatgttcaaaca	U12542	Human ROM-K potassium channel protein isoform romk2 mRNA, complete
gctctataccagtgaatgccaactgt	U12543	Human ROM-K potassium channel protein isoform romk3 mRNA, complete
gtgttgacagaaagtatgttcaaaca	U12544	Human ROM-K potassium channel protein isoform romk4 mRNA, partial
gtgttgacagaaagtatgttcaaaca	U12545	Human ROM-K potassium channel protein isoform romk5 mRNA, partial
ccggccgtcagtaccatggacagcag	U12569	Human mu opioid receptor variant (MOR1) mRNA, complete cds.
ccaccattgaaagccatgaattttga	U12590	Human HOXB2 gene, promoter region.
caagatgaactggtgatgctcgtgga	U12596	Human tumor necrosis factor type 1 receptor associated protein
ggggtcacagctctcatggctgcagc	U12597	Human tumor necrosis factor type 2 receptor associated protein
agggcagaaagcaccatgagtggggg	U12707	Human Wiskott-Aldrich syndrome protein (WASP) mRNA, complete cds.
gctctcttgaccactatgagcctcct	U12709	Human neutrophil-activating ENA-78 prepeptide gene, complete cds.
tacaccaagctgaccatggaccttgg	U12767	Human mitogen induced nuclear orphan receptor (MINOR) mRNA,
attcctgcgccgaggatggagggcct	U12778	Human acyl-CoA dehydrogenase mRNA, complete cds.
gcgtccccgggcaccatgctgtccaa	U12779	Human MAP kinase activated protein kinase 2 mRNA, complete cds.
gaccgagaccgcttcatggatgagtt	U12918	Human syntaxin mRNA, complete cds.
aagccagaggaaaaaccagaaaaaaa	U12969	Human endogenous retroviral element clone pCRTK6 nucleocapsid
aaaccagaagaaaaaccagaagagaa	U12970	Human endogenous retroviral element clone pCRTK1 nucleocapsid
agctggagtctgaagatggagaccaa	U12978	Homo sapiens BS-84 (HSD-1) mRNA, complete cds.
ttgggagtgtgtggcatgcatcctca	U13022	Human negative regulator of programmed cell death ICH-1S (Ich-1)
tgaaatactccagccatgactaaaag	U13044	Human nuclear respiratory factor-2 subunit alpha mRNA, complete
ccgaagcttttccagatgtccctggt	U13045	Human nuclear respiratory factor-2 subunit beta 1 mRNA, complete
ccgaagcttttccagatgtccctggt	U13046	Human nuclear respiratory factor-2 subunit beta 2 mRNA, complete
ccgaagcttttccagatgtccctggt	U13047	Human nuclear respiratory factor-2 subunit gamma 1 mRNA, complete
ccgaagcttttccagatgtccctggt	U13048	Human nuclear respiratory factor-2 subunit gamma 2 mRNA, complete
ctgggagccgccgccatgggaatgtc	U13173	Human intestinal H+/peptide cotransporter (Hpept1) gene, complete
cacctcgaagccaacatgaaggagac	U13214	Human protaglandin receptor EP3F mRNA, complete cds.
cacctcgaagccaacatgaaggagac	U13215	Human protaglandin receptor EP3E mRNA, complete cds.
cacctcgaagccaacatgaaggagac	U13216	Human protaglandin receptor EP3A1 mRNA, complete cds.
cacctcgaagccaacatgaaggagac	U13217	Human protaglandin receptor EP3D mRNA, complete cds.
cacctcgaagccaacatgaaggagac	U13218	Human protaglandin receptor EP3A mRNA, complete cds.
ggaggcggcgcggccatggaccccgc	U13219	Human forkhead protein FREAC-1 mRNA, complete cds.
gctcccgggtcccagatgaccaccga	U13220	Homo sapiens forkhead protein FREAC-2 mRNA, complete cds.
gctctctcgggcaacatggcgggtgt	U13261	Homo sapiens eIF-2-associated p67 homolog mRNA, complete cds.
cgcttcattagcacttaccatgcctt	U13369	Human ribosomal DNA complete repeating unit.
ttggcctgcaggaacatggcaagggc	U13395	Human oxidoreductase (HHCMA56) mRNA, complete cds.
ctttttaaatgcattatggctcatgc	U13616	Human ankyrin G (ANK-3) mRNA, complete cds.
gcggctggccagaggatgagactccc	U13660	Human cartilage-derived morphogenetic protein 1 (CDMP-1) mRNA,
atttccatcagcaggatgtgggggct	U13665	Human cathepsin O (CTSO) mRNA, complete cds.
ccatttagcaaggtcatggaagattt	U13666 L35539	Human G protein-coupled receptor (GPR1) gene, complete cds.
tctcctgcaggtaccatgatgtgggg	U13668 L35538	Human G protein-coupled receptor (GPR3) gene, partial cds.
gcatttgttctccaaatgtcaactgt	U13680	Human lactate dehydrogenase-C (LDH-C) mRNA, complete cds.
ctgttaaaagcgaaaatgaaacaatt	U13695	Human homolog of yeast mutL (hPMS1) gene, complete cds.
tcgggtgttgcatccatggagcgagc	U13696	Human homolog of yeast mutL (hPMS2) gene, complete cds.
caactccaaactaacatggcagtcag	U13706	Human ELAV-like neuronal protein 1 isoform Hel-N2 (Hel-N1) mRNA,
ttaataaaggtatccatggagaacac	U13737	Human cysteine protease CPP32 isoform alpha mRNA, complete cds.
ttaataaaggtatccatggagaacac	U13738	Human cysteine protease CPP32 isoform beta mRNA, complete cds.
tgattctggagaaaaatgccggtccg	U13896	Human homolog of Drosophila discs large protein, isoform 2 (hdlg-2)
tgattctggagaaaaatgccggtccg	U13897	Human homolog of Drosophila discs large protein, isoform 1 (hdlg-1)
tgcccgttgctagctatggcaaatgg	U13913	Human large-conductance calcium-activated potassium channel (hSlo)
agcggcaaagcccgaatggtctctag	U13948	Human zinc finger/leucine zipper protein (AF10) mRNA, complete cds.
gaacgtgcgggcaccatgcgtcccca	U13989	Human secretin receptor mRNA, complete cds.
tctcccaccggcccgatgagctgcag	U13991	Human TATA-binding protein associated factor 30 kDa subunit
acgcgaacagggaccatgcagggcaa	U14108	Human Mel-1a melatonin receptor mRNA, complete cds.
gcggcggctccggggatggcggcggc	U14187	Homo sapiens LERK-3 (EPLG3) mRNA, complete cds.
cggacctcgggggcgatgcggctgct	U14188	Homo sapiens LERK-4 (EPLG4) mRNA, complete cds.
tcttcctcctaagccatggcatatca	U14193	Homo sapiens transcription factor IIA small 12 kDa subunit (GTF2A2)
gcggcgcgagtcaccatgggaagcaa	U14391	Human myosin-IC mRNA, complete cds.
gcggcagcagcggcaatgaccccttg	U14394	Human tissue inhibitor of metalloproteinases-3 mRNA, complete cds.
ccgtggctttgagtaatgagaatttc	U14407	Human interleukin 15 (IL15) mRNA, complete cds.
ccctgggccacgccgatgactactgc	U14510	Human transcription factor NFATx mRNA, complete cds.
cctctgcggcgtgtcatgggcccgcg	U14518	Human centromere protein-A (CENP-A) mRNA, complete cds.
catctatctccagaaatgtcttcaga	U14528	Human sulfate transporter (DTD) mRNA, complete cds.
gcgggccggggctgtatggggctccc	U14550	Human sialyltransferase SThM (sthm) mRNA, complete cds.
ggtcgattcaggaacatggtgcaaac	U14575	Human (ard-1) mRNA, complete cds.
gaaaaggtcaaggccatggaagagaa	U14577	Human microtubule-associated protein 1A (MAP1A) mRNA, complete cds.
tgcagagatttcatcatggtctccca	U14580	Human coagulation factor VII gene, promoter region and partial cds.
gcccgtggtccggccatggacgacct	U14588	Human paxillin mRNA, complete cds.
tttttatttgccataatgaaccgtcc	U14603	Human protein-tyrosine phosphatase (HU-PP-1) mRNA, partial
gcccgctgggccgccatggagcgctg	U14631	Human 11 beta-hydroxysteroid dehydrogenase type II mRNA, complete
cgtggtagccccaggatgggtgagtt	U14650	Human platelet-endothelial tetraspan antigen 3 mRNA, complete cds.
ttggaacagaaagaaatggatttatc	U14680	Homo sapiens breast and ovarian cancer susceptibility (BRCA1) mRNA,
cgctgtaactgcaggatggggaagca	U14747	Human visinin-like peptide 1 homolog mRNA, complete cds.
accaaaccaaagaccatggttcactg	U14755	Human LIM domain transcription factor LIM-1 (hLIM-1) mRNA, complete
tgagggagagtgaggatggcagagac	U14910	Human RPE-retinal G protein-coupled receptor (rgr) mRNA, complete
gggggcgccgggactatgtcgcgggc	U14939	Human folylpolyglutamate synthetase gene, partial cds.
acataggaggcggccatggcgacccc	U14957	Homo sapiens type II phosphatidylinositol-4-phosphate 5-kinase 53K
gtctctgttccgcagatggggtttgt	U14966	Human ribosomal protein L5 mRNA, complete cds.
cagtaattcgccaaaatgacgaacac	U14967	Human ribosomal protein L21 mRNA, complete cds.
gtctgggctgccaacatgccatccag	U14968	Human ribosomal protein L27a mRNA, complete cds.
gagggagccgccgccatgtctgcgca	U14969	Human ribosomal protein L28 mRNA, complete cds.
ggctgtgttctcaggatgaccgagtg	U14970	Human ribosomal protein S5 mRNA, complete cds.
ggaagcggacgcaacatgccagtggc	U14971	Human ribosomal protein S9 mRNA, complete cds.
cctgcagccgcagagatgttgatgcc	U14972	Human ribosomal protein S10 mRNA, complete cds.
actgctgagagcaagatgggtcacca	U14973	Human ribosomal protein S29 mRNA, complete cds.
agcgtagtgaccatcatgagcctcct	U15008	Human SnRNP core protein Sm D2 mRNA, complete cds.
tctcttcctgccaagatgtctattgg	U15009	Human SnRNP core protein Sm D3 mRNA, complete cds.
tttacagagcagagcatgatcacatt	U15085	Human HLA-DMB mRNA, complete cds.
ccggccctggagaccatgaggttccg	U15128 L36537	Human beta-1,2-N-acetylglucosaminyltransferase II (MGAT2) gene,
ttgcagagagccgaaatgaccatgac	U15131	Human p126 (ST5) mRNA, complete cds.
gaatccaggctgaggatggaaggtgt	U15173	Homo sapiens BCL2/adenovirus E1B 19kD-interacting protein 2 (BNIP2)
ttgccctctggcgccatgtccgagaa	U15174	Homo sapiens BCL2/adenovirus E1B 19kD-interacting protein 3 (BNIP3)
agaggagatggaaacatgcagagaga	U15177	Human cosmid CRI-JC2015 at D10S289 in 10sp13.
accagacgcggagccatggccgaggt	U15198	Human histo-blood group ABO protein gene, partial cds.
caaacgtggcctcctatggacaccca	U15422	Human protamine 1 (PRM1), protamine 2 (PRM2) and transition protein
cggaagatttcagccatgcctcacag	U15460	Human bZip protein B-ATF mRNA, complete cds.
gagggagccggaaagatggtggttac	U15552	Human acidic 82 kDa protein mRNA, complete cds.
gtttttgccttcactatggcaaaaat	U15590	Homo sapiens heat shock 17kD protein 3 (HSPB3) mRNA, complete cds.
ctcctctttcctaaaatggagtcgag	U15637	Homo sapiens CD40 binding protein (CD40BP) mRNA, complete cds.
cggcgggcgggcgcgatggcggaggc	U15641	Human transcription factor E2F-4 mRNA, complete cds.
ccgggacgcgacgcgatggcggcggc	U15642	Human transcription factor E2F-5 mRNA, complete cds.
cccgggccccccagcatgaagacccc	U15655	Human ets domain protein ERF mRNA, complete cds.
ttgcagagagccgaaatgaccatgac	U15780	Human p82 (ST5) mRNA, alternatively spliced, complete cds.
taatcagctgaggccatgtcaggaga	U15782	Human cleavage stimulation factor 77kDa subunit mRNA, complete cds.
ggcggcggcggcggcatgaaggtcac	U15932	Human dual-specificity protein phosphatase mRNA, complete cds.
cgtggcctgagcaggatggtgccctc	U15939	Human placental folate transporter (hFOLT1) mRNA, complete cds.
cccggccgcccagagatgaccgcgac	U15979	Human (dlk) mRNA, complete cds.
cccggccgcccagagatgaccgcgac	U15981	Human (dlk) mRNA, alternatively spliced, complete cds.
ccccacaacatgcgtgtcccaggctg	U16020	Human Na+/H+ exchanger NHE3 related pseudogene and ALU-like
gagtaaggggtcccaatgtctacagc	U16028	Human CRE-BP1 transcription factor mRNA, complete cds.
tccaagtcccagatcatgtctctgtg	U16031	Human transcription factor IL-4 Stat mRNA, complete cds.
aaacaaagcaaggagatggccaccaa	U16120	Human placental taurine transporter mRNA, complete cds.
cggcggcgcccaacgatgaccgctcc	U16127	Human glutamate/kainate receptor subunit (EAA5) mRNA, complete cds.
ggcgagggcggcgcgatgaaggcggt	U16153	Human Id-4H protein mRNA, complete cds.
ggagagctgaatgagatgaggacccg	U16258	Human I kappa BR mRNA, complete cds.
acacgagactgagagatgaattttca	U16261	Human MDA-7 (mda-7) mRNA, complete cds.
cggaactcgggcatcatggcctcaga	U16267	Human AMP deaminase isoform L, alternatively spliced (AMPD2) mRNA,
ggttgcctagacaacatgagaaatcg	U16268	Human AMP deaminase isoform L, alternatively spliced (AMPD2) mRNA,
cgagcgagcccgaggatgggagggca	U16273	Human corticotropin releasing hormone receptor variant mRNA,
taagaccataaaaccatgggaaacgc	U16296	Human T-lymphoma invasion and metastasis inducing TIAM1 protein
ccttccaaggccaagatgttcataaa	U16306	Human chondroitin sulfate proteoglycan versican V0 splice-variant
gctacaatagcctggatggtttcttt	U16307	Homo sapiens glioma pathogenesis-related protein (GliPR) mRNA,
gaccccgcggccaccatgtatgtggg	U16360	Human caudal-type homeobox protein (CDX1) gene, partial cds.
acgaaggcggcggcgatggcggcggg	U16660	Homo sapiens peroxisomal enoyl-CoA hydratase-like protein (HPXEL)
cttgcaaaagaaggcatgcacagctc	U16720	Human interleukin 10 (IL10) gene, complete cds.
ccgcccgcccgcgccatgaacgccaa	U16752	Human cytokine SDF-1-beta mRNA, complete cds.
tgacccgccatcgccatggcccgcgg	U16799	Human Na,K-ATPase beta-1 subunit mRNA, complete cds.
actgagacctgaaaaatggcttcggg	U16811	Human Bak mRNA, complete cds.
actgagacctgaaaaatggcttcggg	U16812	Human Bak-2 gene, complete cds.
actgagacctgaaaaatggcatcggg	U16813	Human Bak-3 pseudogene, complete cds.
cggagtgggccagagatggcggcggc	U16815	Human excision repair-controlling (XPAC) gene, complete cds.
acaagggccacagccatgaatggcac	U16824	Human rhodopsin (RHO) gene, promoter region and exon 1, partial
acgagtttcagaacgatggagagctc	U16826	Human cocaine and amphetamine regulated transcript CART (hCART)
tccccagcagaagcaatgggcagtgt	U16861	Human inward rectifying potassium channel mRNA, complete cds.
ttgggtttttgaaacatgcatctgta	U16953	Human potassium channel beta3 subunit mRNA, complete cds.
tgataacaggaagctatgagggaccc	U16954	Human (AF1q) mRNA, complete cds.
tgctgacatttcaatatgaagggcaa	U16957	Human angiotensin II type 2 receptor mRNA, complete cds.
ggcggcggcggcggcatgaaggtcac	U16996	Human protein tyrosine phosphatase mRNA, complete cds.
caagggagctgccccatggacagggc	U16997	Human orphan receptor ROR gamma mRNA, complete cds.
ggtgatagaggaaacatggccgagta	U17031	Human enoyl-CoA hydratase: 3-hydroxyacyl-CoA dehydrogenase gene,
catgagaagagagttatgatggcaaa	U17032	Human p190-B (p190-B) mRNA, complete cds.
gcccagtggttagcgatgctgctgtc	U17033	Human 180 kDa transmembrane PLA2 receptor mRNA, complete cds.
gcccagtggttagcgatgctgctgtc	U17034	Human soluble PLA2 receptor mRNA, complete cds.
gagagctgtgtcaccatgtgggtccc	U17040	Human prostate specific antigen precursor mRNA, complete cds.
gacaccccggccagaatggagctgac	U17071	Human megakaryocyte growth and development factor precursor (MGDF)
tcaggaccctaaagaatggccgagcc	U17074	Human CDK6 inhibitor p18 mRNA, complete cds.
tctgggggctgcggaatgcgcgagga	U17075	Human p14-CDK inhibitor mRNA, complete cds.
tagcccagcatcactatggtggacgc	U17081	Human fatty acid binding protein (FABP3) gene, complete cds.
ggccgcggggaggacatggccgcgca	U17084 U09106	Human neurofibromin (NF1) gene, promoter region and partial cds.
gagctcatgcgcagtatgtgtggttg	U17179	Human prohibitin gene, exon 1, promoter region, and partial cds.
acgtcaggagccaagatggcggcggt	U17248	Human succinate dehydrogenase iron-protein subunit (sdhB) gene,
gaagccaacgggcggatggttattcc	U17278	Human collapsin response mediator protein CRMP-1 mRNA, complete
tttcccaggagagagatgtcttatca	U17279	Human collapsin response mediator protein hCRMP-2 mRNA, complete
atttgccaggaaacaatgctgctagc	U17280	Human steroidogenic acute regulatory protein (StAR) mRNA, complete
cggaagctagttaccatggaggatca	U17327	Human neuronal nitric oxide synthase (NOS1) mRNA, complete cds.
ccctaggcggtggcgatggggaccgc	U17418	Human parathyroid hormone/parathyroid hormone-related peptide
cattttggcttaatgatggagaaaaa	U17473	Human calcitonin-like receptor mRNA, complete cds.
aaggtcctctatgtgatggagctgct	U17474	Human autoantigen mRNA, complete cds.
gggtggctggcggtcatggcgctact	U17496	Human proteasome subunit LMP7 (allele LMP7B) mRNA, complete cds.
gggtggctggcggtcatggcgctact	U17497	Human proteasome subunit LMP7 (allele LMP7C) mRNA, complete cds.
cgtggcctgagcaggatggtgccctc	U17566	Human 65 kDa hydrophobic protein mRNA, complete cds.
caccacctccctaccatggacccccg	U17714	Homo sapiens putative tumor suppressor ST13 (ST13) mRNA, complete
tcttcactcccaacaatggcggctcc	U17743	Human JNK activating kinase (JNKK1) mRNA, complete cds.
caacaggaattgaaaatgaatcagaa	U17838	Homo sapiens zinc finger protein RIZ mRNA, complete cds.
cctcccctgacagccatgctggtcgt	U17894	Human alpha(1,2)fucosyltransferase (FUT2) gene, complete cds.
ccctgcctcctgaccatgtcctctct	U17895	Human alpha(1,2)fucosyltransferase (Sec1) pseudogene.
ccgcactctgctgctatgagcttcct	U17899	Human chloride channel regulatory protein mRNA, complete cds.
tcgaagcctcttaaaatggcagatga	U17969	Human initiation factor eIF-5A gene, complete cds.
gtctcggaggccaggatgcctgccct	U17970	Human heparan sulfate N-deacetylase/N-sulfotransferase mRNA,
ggctgaaagcaagcaatgctccccac	U17986	Human GABA/noradrenaline transporter mRNA, complete cds.
ggggccccacacacaatggacgagct	U17989	Homo sapiens nuclear autoantigen GS2NA mRNA, complete cds.
cacaaggaaataaagatgagtaaaag	U18062	Human TFIID subunit TAFII55 (TAFII55) mRNA, complete cds.
actgggtgagcaataatggtgcttcc	U18088	Human 3',5'-cyclic AMP phosphodiesterase inactive splice variant
tgcctcgcgggcgcaatgaatccgcg	U18121	Human 136-kDa double-stranded RNA binding protein p136 (K88dsRBP)
ggtctctctgcagccatgtcggccaa	U18197	Human ATP:citrate lyase mRNA, complete cds.
actgtggacgggaggatggagtcgat	U18242	Human calcium modulating cyclophilin ligand (CAMLG) mRNA, complete
aagacgttgaggagtatgaggacctg	U18247	Human p67 mRNA, complete cds.
tgggattcctacacaatgcgttgcct	U18259	Human clone CIITA-8 MHC class II transactivator CIITA mRNA,
tgggattcctacacaatgcgttgcct	U18288	Human clone CIITA-10 MHC class II transactivator CIITA mRNA,
cgggcccgcgccgccatgaacctaga	U18291	Human CDC16Hs mRNA, complete cds.
ctgctggcatcggccatggagacggt	U18297	Human MST1 (MST1) mRNA, complete cds.
gctccaagcctcgacatgtcgtacaa	U18299	Human damage-specific DNA binding protein DDBa p127 subunit (DDB1)
cacacggaggacgcgatggctcccaa	U18300	Human damage-specific DNA binding protein p48 subunit (DDB2) mRNA,
tccaggagtgcaaggatgatgctgaa	U18321	Human ionizing radiation resistance conferring protein mRNA,
acagctggacgggcaatggcgggtcg	U18420	Human ras-related small GTP binding protein Rab5 (rab5) mRNA,
atccgcgggtttgctatggcgatgag	U18423	Human spinal muscular atrophy gene product mRNA, complete cds.
cagggagcagagaccatggggcccct	U18467	Human pregnancy-specific beta 1-glycoprotein 7 (PSG7) mRNA,
caagcagcagagaccatggggcccct	U18469	Human pregnancy-specific beta 1-glycoprotein 4 (PSG4) clone FL-64
ttcaaaggaagagcaatggctgcagc	U18543	Human zinc-finger protein mRNA, complete cds.
aggacaggggttaaaatgaatgaaga	U18548	Human GPR12 G protein coupled-receptor gene, complete cds.
gcaaatccggccgcgatgaacgcgag	U18549	Human GPR6 G protein-coupled receptor gene, complete cds.
tctcctgcaggtaccatgatgtgggg	U18550	Human GPR3 G protein-coupled receptor gene, complete cds.
ttctgcagagcccaaatggcgcagtg	U18671	Human Stat2 gene, complete cds.
aaccatttgccaaaaatgagtctaag	U18728	Human lumican mRNA, complete cds.
gggtgcttcagatcaatggatgagtt	U18759	Human nuclear factor I (NFI) mRNA, clone AT1, complete cds.
tcctcctcgccccgcatgctcccggc	U18761	Human nuclear factor I (NFI) mRNA, clone CT1, partial cds.
cacgctgagctcgggatgcggacgct	U18810	Human PACAP type-3/VIP type-2 receptor mRNA, complete cds.
cggcgggctggagacatggaccgcgg	U18914	Human 19.8 kDa protein mRNA, complete cds.
gtctcggaggccaggatgcctgccct	U18918	Human heparan sulfate-N-deacetylase/N-sulfotransferase mRNA, clone
gcggcgtcgccgccgatggcgctgag	U18934	Human receptor tyrosine kinase (DTK) mRNA, complete cds.
aagtggacagccgggatggcagagcg	U18936	Human histidyl-tRNA synthetase homolog (HO3) gene, exon 1, and
gcgtcctgccgcgcgatgcccctgct	U18937	Human histidyl-tRNA synthetase homolog (HO3) mRNA, complete cds.
taagcaggcatcaggatgttgggctg	U18945	Human cyclic nucleotide gated channel gamma subunit (Gar-1) mRNA,
cttttgacgaccaccatgactgagat	U18985	Human triadin mRNA, complete cds.
ctgaactggaagaaaatgtctatcca	U18991	Human retinal pigment epithelium-specific 61 kDa protein (RPE65)
ggtgccaaagcagccatggaagagcc	U19107	Homo sapiens ZNF127 (ZNF127) gene, complete cds; and FNZ127 gene,
tcatctgtgtgaaatatgagttggcg	U19142	Human GAGE-1 protein mRNA, complete cds.
tcatctgtgtgaaatatgagttggcg	U19143	Human GAGE-2 protein mRNA, complete cds.
tcatatttcacacagatgaatctcag	U19144	Human GAGE-3 protein mRNA, complete cds.
tcatctgtgtgaaatatgagttggcg	U19145	Human GAGE-4 protein mRNA, complete cds.
tcatctgtgtgaaatatgagttggcg	U19146	Human GAGE-5 protein mRNA, complete cds.
tcatctgtgtgaaatatgagttggcg	U19147	Human GAGE-6 protein mRNA, complete cds.
gagagctcccgcctcatgtttgaata	U19178	Human (Hin-3)/HIV1 promoter region chimeric mRNA, complete cds.
acgccacctttgatcatggaagaaag	U19179	Human (Hin-2) mRNA, complete cds.
ggctggagcagtaagatggcggccag	U19180	Human B melanoma antigen (BAGE) mRNA, complete cds.
gataaacctcagaaaatggccaccca	U19251	Homo sapiens neuronal apoptosis inhibitory protein mRNA, complete
tgacgccggacgcccatggacgcctc	U19252	Human putative transmembrane protein mRNA, complete cds.
ctcctctttcctaaaatggagtcgag	U19260	Human LMP1 associated protein mRNA, complete cds.
gcctggaaccctgagatggcctccag	U19261	Homo sapiens Epstein-Barr virus-induced protein mRNA, complete cds.
cctggccccaccgacatggcggcggt	U19348	Human (tpr-met fusion) oncogene mRNA, complete cds.
tccaggcaccccaccatgggcaatgc	U19487	Human prostaglandin E2 receptor mRNA, complete cds.
ccgcccgcccgcgccatgaacgccaa	U19495	Human intercrine-alpha (hIRH) mRNA, complete cds.
ctggccagtcccaaaatggaacataa	U19517	Human (apoargC) long mRNA, complete cds.
ctggccagtcccaaaatggaacataa	U19518	Human (apoargC) short mRNA, complete cds.
ggctgcggcgggtccatggagaaggg	U19523	Human GTP cyclohydrolase I mRNA, complete cds.
cacatcgagttcaccatgaattcact	U19556	Human squamous cell carcinoma antigen 1 (SCCA1) mRNA, complete cds.
cacatcgagttcaccatgaattcact	U19557	Human squamous cell carcinoma antigen 2 (SCCA2) mRNA, complete cds.
agcatctgctgagctatgagccaaac	U19713	Human allograft-inflammatory factor-1 mRNA, complete cds.
tgcctctttgttgccatgagagctgc	U19718	Human microfibril-associated glycoprotein (MFAP2) mRNA, complete
cgtggcctgagcaggatggtgccctc	U19720	Human reduced folate carrier (RFC) mRNA, complete cds.
ttgcagtggtgcagaatggctgacct	U19727	Human microtubule-associated protein 4 (MAP4) mRNA, complete cds.
gatctgactgcagccatgagcagcaa	U19765	Human nucleic acid binding protein gene, complete cds.
agaaggcagaacaaaatgagctgggc	U19769	Human CENP-F kinetochore protein mRNA, complete cds.
ggcggctgctggaaaatgtctcagga	U19775	Human MAP kinase Mxi2 (MXI2) mRNA, complete cds.
acagtgactgtgaccatgcggaccct	U19796	Human melanoma antigen p15 mRNA, complete cds.
agccgccgccgaatcatgtcgatgag	U19816	Human thyroid transcription factor-1 (TTF-1) gene, complete cds.
cagcctcccagcagcatggctttcac	U19869	Homo sapiens fatty acid binding protein 6 (FABP6) mRNA, complete
acaggggcaccagtcatgggcgccgc	U19878	Human transmembrane protein mRNA, complete cds.
agctgcatggacagcatgcgtctctc	U19906	Human arginine vasopressin receptor 1 (AVPR1) gene, complete cds.
agggcagaaagcaccatgagtggggg	U19927	Human Wiskott-Aldrich syndrome (WAS) mRNA, complete cds.
agaagctggcggctcatggcttcgtg	U19948	Human protein disulfide isomerase (PDIp) mRNA, complete cds.
gcagacatggggaccatgaagaccca	U19970	Human antimicrobial LPS-binding protein CAP18 precursor mRNA,
tcaacacttcactccatggcagttcc	X06347	Human mRNA for U1 small nuclear RNP-specific A protein.
gaattccagagcaacatgcccaagtt	X12517	Human mRNA for U1 small nuclear RNP-specific C protein.
tgctcagctcccaagatggtgccacc	U20157	Human platelet-activating factor acetylhydrolase mRNA, complete
cccgggagagcagccatggcactgag	U20158	Human 76 kDa tyrosine phosphoprotein SLP-76 mRNA, complete cds.
ttggctggcccagggatgacttcctc	U20165	Human type II serine/threonine kinase receptor mRNA, complete cds.
tggcatgttgcaaagatggtttctgc	U20166	Human GABA(A) receptor alpha 4 subunit (GABRA4) gene, partial cds.
gaacgtgcgggcaccatgcgtcccca	U20178	Human secretin receptor precursor mRNA, complete cds.
cctcaaacagacaccatggtgcacct	U20223	Human thalassemia beta globin gene, complete cds.
aacgtgattggggtcatgaagacgtt	U20230	Human guanyl cyclase C gene, partial cds.
agggagagtgcccaaatgagcaagat	U20240	Human C/EBP gamma mRNA, complete cds.
atttccatcagcaggatgtgggggct	U20280	Human cathepsin X mRNA, complete cds.
gaagttccagaatcgatggaagtgga	U20285	Human Gps1 (GPS1) mRNA, complete cds.
cagatagtcttcaagatgccaaactg	U20324	Human LIM domain protein (CLP) mRNA, complete cds.
acgagtttcagaacgatggagagctc	U20325	Human cocaine and amphetamine regulated transcript CART (hCART)
cgccaggccttcaccatggatcagtt	U20350	Human G protein-coupled receptor V28 mRNA, complete cds.
cagcgcgaggtacaaatgatgcaaaa	U20362	Human Tg737 mRNA, complete cds.
tcttcagggacagacatggctcagcg	U20391	Human folate receptor (FOLR1) gene, complete cds.
ccccgtccgcgcacgatggggcacct	U20489	Human glomerular epithelial protein 1 (GLEPP1) mRNA, complete cds.
ccctgatgcaggaacatggagctgat	U20499	Human thermolabile phenol sulfotransferase (stm) gene, complete
gcgcgtttggctgcaatgagctcggc	U20536	Human cysteine protease Mch2 isoform alpha (Mch2) mRNA, complete
acctggtctgggaagatgttctacca	U20659	Human RNA polymerase II subunit hsRPB7 mRNA, complete cds.
gcctgggccgcccggatgtgcactaa	U20734	Human transcription factor junB (junB) gene, 5' region and complete
ggaaaactcactaccatgagaattgc	U20758	Human osteopontin gene, complete cds.
agagacggcagaaccatggcatttta	U20759	Human parathyroid cell calcium-sensing receptor mRNA, complete cds.
agagacggcagaaccatggcatttta	U20760	Human extracellular calcium-sensing receptor mRNA, complete cds.
tccaggactggcgggatgggctcagc	U20770	Human metastasis suppressor (KAI1) mRNA, complete cds.
gcctagcccagagacatggagagttg	U20816	Human nuclear factor kappa-B2 (NF-KB2) gene, partial cds.
tgctgacatttcaatatgaagggcaa	U20860	Human angiotensin II type 2 receptor gene, complete cds.
ttcttgacgcccagaatggtcagtgc	U20896	Human clone 122/3 melanoma ubiquitous mutated protein (MUM-1) gene,
actgtaggcactgccatggcccctgt	U20938	Human lymphocyte dihydropyrimidine dehydrogenase mRNA, complete
ggagccgctgccgctatggatgatcg	U20972	Human 14-3-3 protein epsilon isoform mRNA, complete cds.
ggagccgccacagccatggattgcaa	U20979	Human chromatin assembly factor-I p150 subunit mRNA, complete cds.
tcgagactcaggaggatgaaagtcat	U20980	Human chromatin assembly factor-I p60 subunit mRNA, complete cds.
gtcctcgggcggtccatgctgcccct	U20982	Human insulin-like growth factor binding protein-4 (IGFBP4) gene,
ccactctaggccacgatgccgcagta	U20998	Homo sapiens signal recognition particle subunit 9 (SRP9) mRNA,
ggagctgctgcagccatgtcggccct	U21049	Homo sapiens DD96 mRNA, complete cds.
gccgaagtgcccaccatgggcaacca	U21051	Human G protein-coupled receptor (GPR4) gene, complete cds.
gtcaggagtgtggccatgttttctga	U21090	Human DNA polymerase delta small subunit mRNA, complete cds.
ctcctctttcctaaaatggagtcgag	U21092	Human CD40 receptor associated factor 1 (CRAF1) mRNA, complete cds.
cggttcccggcgaccatggtgacgat	U21108	Human dual specific protein phosphatase mRNA, complete cds.
aaccatttgccaaaaatgagtctaag	U21128	Human lumican mRNA, complete cds.
tcttcctcctaagccatggcatatca	U21242	Homo sapiens transcription factor TFIIA small subunit p12 mRNA,
ctgcctgccaccaccatgtctgctgc	U21663	Human deleted in azoospermia protein (DAZ) mRNA, complete cds.
gcagtcttcgccaccagtgagtacgc	U21689	Human glutathione S-transferase-P1c gene, complete cds.
tcacgcgccacagctatgtgtccccg	U21730	Human 5'-nucleotidase (CD73) gene, partial cds.
gccaagcagccaaccatgctcaactt	U21847	Human TGF-beta inducible early protein (TIEG) mRNA, complete cds.
tgatcatcggatatcatggagtctgg	U21858	Human transcriptional activation factor TAFII32 mRNA, complete cds.
ctgggagccgccgccatgggaatgtc	U21936	Human peptide transporter (HPEPT1) mRNA, complete cds.
accctgaagagcaacatgggagaaac	U21943	Human organic anion transporting polypeptide (OATP) mRNA, complete
catccctctaccaccatgctggcctc	U22027	Human cytochrome P450 (CYP2A6V2) gene, complete cds.
catcccatggccaccatgctggcctc	U22028	Human cytochrome P450 (CYP2A13) gene, complete cds.
catctcactaccaccatgctggcctc	U22029	Human cytochrome P450 (CYP2A7) mRNA, complete cds.
catctcactaccaccatgctggcctc	U22030	Human cytochrome P450 (CYP2A7PT) pseudogene mRNA, partial cds.
catctcactaccaccatgctggcctc	U22044	Human cytochrome P450 (CYP2A7PC) pseudogene mRNA, partial cds.
cggggcatcatcaagatggtcctctc	U22055	Human 100 kDa coactivator mRNA, complete cds.
tcaaccagaatcaagatgtctgggac	U22171	Human DNA repair and recombination RAD52 pseudogene, partial cds.
ctttcccgtgcagacatggcctctgg	U22233	Human methylthioadenosine phosphorylase (MTAP) mRNA, complete cds.
accagacgcggagccatggccgaggt	U22302	Homo sapiens histo blood group ABO glycosyltransferase (ABO) gene,
tggccgaatacagttatggccaccca	U22314	Human REST protein mRNA, complete cds.
ccccaccaaggcacaatgagcaacat	U22322	Human nuclear tyrosine protein kinase Rak mRNA, complete cds.
ttcaggtcactgtgcatggcatcatc	U22346	Human bradykinin B1 receptor (bradyb1) gene, complete cds.
gccgcccgccgcgccatggcccgaag	U22376	Human (c-myb) gene, complete primary cds, and five complete
gacccagctgcccgtatgaccgcgcc	U22386	Human macrophage-colony stimulating factor gamma precursor mRNA,
gcgcagccccgggccatgtccgacgc	U22398	Human Cdk-inhibitor p57KIP2 (KIP2) mRNA, complete cds.
ggggaccgattcaccatggagggcgc	U22431	Human hypoxia-inducible factor 1 alpha (HIF-1 alpha) mRNA, complete
tctgccctcgttgagatggacaacgc	U22491	Human G protein-coupled receptor (GPR7), complete cds.
acggtcccagctacaatgcaggccgc	U22492	Human G protein-coupled receptor gene (GPR8), complete cds.
agcactgcagcagcaatgacggaggg	U22526	Human 2,3-oxidosqualene-lanosterol cyclase mRNA, complete cds.
gggctccagaaagagatgtccttgtg	U22662	Human nuclear orphan receptor LXR-alpha mRNA, complete cds.
aggccgaatacagttatggccaccca	U22680	Human X2 box repressor mRNA, complete cds.
ccgccggcgagcaagatgatgtgcga	U22815	Human LAR-interacting protein 1a mRNA, complete cds.
ccgccggcgagcaagatgatgtgcga	U22816	Human LAR-interacting protein 1b mRNA, complete cds.
ccctggacccctaccatggaggagac	U22897	Homo sapiens nuclear domain 10 protein (ndp52) mRNA, complete cds.
ggacagagcgtgaccatggccaggct	U22954	Human immunoglobulin-associated (B29) gene, promoter and exon 1,
cacgcctttggcacaatgaagtgggt	U22961	Human mRNA clone with similarity to L-glycerol-3-phosphate:NAD
gcgcgcggcgccaccatgcggcagaa	U22970 Y00828	Human interferon-inducible peptide (6-16) gene, complete cds.
ccgtgcggggcgtcaatggatcgcca	U23070	Human putative transmembrane protein (nma) mRNA, complete cds.
gggcagctggtcaggatggccattcg	U23143	Human mitochondrial serine hydroxymethyltransferase gene, nuclear
aaggctctgataaccatgaggcttct	U23157	Human pro-alpha-S1-casein mRNA, complete cds.
acaccttggccaacaatgtcctgcag	U23435	Human Abl interactor 2 (Abi-2) mRNA, complete cds.
ccgtccgccgcggccatggccaccac	U23460	Human proline rich calmodulin-dependent protein kinase mRNA,
gccctgcaacggatcatggtgcagca	U23752	Human SOX-11 mRNA, complete cds.
actgagacctgaaaaatggcttcggg	U23765	Human Bak protein mRNA, complete cds.
gcccgggccttggagatggagaattc	U23803	Human heterogeneous ribonucleoprotein A0 mRNA, complete cds.
tccacagcctgaagaatgaagacacg	U23851	Human atrophin-1 mRNA, complete cds.
ggctgggcagggaccatgggctgtgg	U23852	Human T-lymphocyte specific protein tyrosine kinase p56lck (lck)
gaggcaccggtggccatggggctgga	U23853	Human dual-specific phosphoprotein phosphatase (PAC1) gene,
tttccgacggagtgaatggcggcggc	U23942	Human lanosterol 14-demethylase cytochrome P450 (CYP51) mRNA,
atcttcagtgggacaatgggttcaga	U23946	Human putative tumor suppressor (LUCA15) mRNA, complete cds.
tccccagcagaagcgatgggcagtgt	U24055	Human inward rectifier K+ channel protein (hirk1) mRNA, complete
cgccggcttcaggacatgcacggaca	U24056	Human inward rectifier K+ channel protein (hirk2) mRNA, complete
tgcacagacagcaccatgtcgctcat	U24074	Human p58 natural killer cell receptor precursor mRNA, clone cl-6,
tgctccggcagcaccatgtcgctctt	U24076	Human p58 natural killer cell receptor precursor mRNA, clone cl-42,
tgctccggcagcaccatgtcgctctt	U24078	Human p58 natural killer cell receptor precursor mRNA, clone 47.11,
tcggagacctgagagatgttaaccaa	U24105	Homo sapiens coatomer protein (COPA) mRNA, complete cds.
gcgagtgtgtgagctatggagcgaag	U24128	Human prohormone convertase (PC1/3) gene, promoter and 5' flanking
ctgctggtggtgacaatgtcaaataa	U24152	Homo sapiens p21-activated protein kinase (Pak1) mRNA, complete
tcataattctgaatcatgtctgataa	U24153	Homo sapiens p21-activated protein kinase (Pak2) mRNA, complete
catcctgccgggatcatggtctgcgg	U24163	Human Frizzled related protein Frzb precursor (fzrb) mRNA, complete
tgctttggttctgccatgccgatgta	U24169	Human JTV-1 (JTV-1) mRNA, complete cds.
attctgggcagcaggatgggtgtgga	U24183	Human phosphofructokinase (PFKM) mRNA, complete cds.
tgagctgtcttgaagatgagtaagag	U24186	Homo sapiens replication protein A complex 34 kd subunit homolog
cgcccgccgctcgccatggatgccgg	U24223	Human alpha-CP1 mRNA, complete cds.
cttgcagaccccgccatggacccgtt	U24231	Human Fas-associating death domain-containing protein mRNA,
cgcttctaacccgagatgctgctgcc	U24266	Human pyrroline-5-carboxylate dehydrogenase (P5CDh) mRNA, long
cgcttctaacccgagatgctgctgcc	U24267	Human pyrroline-5-carboxylate dehydrogenase (P5CDh) mRNA, short
acaaccccagactccatgcgcctctc	U24488	Human tenascin-X (XA) mRNA, complete cds.
cgcgctgccctaacgatgccgcccgc	U24497 U24499	Human autosomal dominant polycystic kidney disease protein 1 (PKD1)
tgctcagctcccaagatggtgccacc	U24577	Human LDL-phospholipase A2 mRNA, complete cds.
ttggatcctccagccatgaggctgct	U24578	Human RP1 and complement C4B precursor (C4B) genes, partial cds.
gaagaaactgcaacaatggccaagct	U24660	Human G protein coupled inward rectifier potassium channel 2
gaggaaggtggcaagatggtgttgga	U24704	Human antisecretory factor-1 mRNA, complete cds.
accattcttggaaccatggcggcagt	U25033	Human neuronatin alpha mRNA, complete cds.
accattcttggaaccatggcggcagt	U25034	Human neuronatin beta mRNA, complete cds.
gccgctcgcggaccgatgctgccggc	U25041	Homo sapiens 5C5 mRNA, complete cds.
ttggctggcccagggatgacttcctc	U25110	Human bone morphogenic protein type II receptor mRNA, complete cds.
tgatcatcggatatcatggagtctgg	U25112	Human TBP-associated factor TAFII31 mRNA, complete cds.
acagccgttccgggcatggccgggct	U25128	Human PTH2 parathyroid hormone receptor mRNA, complete cds.
gggaacagacccaagatgttggggag	U25134	Human carbonic anhydrase V (CA-V) gene, nuclear gene encoding
ctgcccccagtgaatatggtgaagaa	U25138	Human MaxiK potassium channel beta subunit mRNA, complete cds.
cgcctcccgcccgccatgcccgcgcc	U25147	Human citrate transporter protein mRNA, nuclear gene encoding
tgcgctcgcgtggtcatggaggcgct	U25182	Human antioxidant enzyme AOE37-2 mRNA, complete cds.
cctctttaacctgtaatgctgtggct	U25265	Human MEK5 mRNA, complete cds.
aggcccggggacaccatggccgagcc	U25278	Human ERK5 mRNA, complete cds.
gtttagaagtttacaatgaagtttct	U25346	Human metalloelastase gene, partial cds and promoter region.
ggagaggcaggggaaatggaaggtga	U25435	Human transcriptional repressor (CTCF) mRNA, complete cds.
cacctcctctgggctatggcatctct	U25441	Human dopamine D3 receptor (DRD3) gene, complete cds.
tcaactcctgccacaatgtacaggat	U25676	Human interleukin 2 (IL2) mRNA, complete cds.
gcgccttagctcactatggggaacca	U25771	Human ADP-ribosylation factor mRNA, complete cds.
cagtaattcgccaaaatgacgaacac	U25789	Human ribosomal protein L21 mRNA, complete cds.
cagaggctgttccctatggcagaagg	U25804	Human Ich-2 cysteine protease mRNA, complete cds.
tctcccaccggcccgatgagctgcag	U25816	Human TATA-binding protein associated factor II 30 (TAFII30) gene,
gagggggcaccgcccatgctgccctg	U25826	Human transcription factor (SC1) gene, complete cds.
cacgcagcagagatcatggggcccct	U25988	Human pregnancy-specific glycoprotein 13 (PSG13') mRNA, complete
gaaacttctcagagaatgctccaaaa	U25997	Homo sapiens stanniocalcin precursor (STC) mRNA, complete cds.
aattaaacaaccaccatgtcgagcaa	U26162	Human myosin regulatory light chain mRNA, complete cds.
gtaaggttgtttctgatgcagctgag	U26173	Human bZIP protein NF-IL3A (IL3BP1) mRNA, complete cds.
atctaaatctttaaaatgactaagtt	U26174	Human pre-granzyme 3 mRNA, complete cds.
ttgctgctccacaccatggccacctg	U26209	Human renal sodium/dicarboxylate cotransporter (NADC1) mRNA,
ccctgacgcaggaacatggagctgat	U26309	Human phenol sulfotransferase mRNA, complete cds.
atcaccaatgacatcatgacagcaag	U26398	Human inositol polyphosphate 4-phosphatase mRNA, complete cds.
gtgcaggcgcgcgtcatggctgcttt	U26401	Human galactokinase (galK) mRNA, complete cds.
cgctggccaggcgtgatgttgcacgt	U26403	Human receptor tyrosine kinase ligand LERK-7 precursor (EPLG7)
tctgtcccggccgccatggagcagcc	U26424	Human Ste20-like kinase (MST2) mRNA, complete cds.
gcccctggccgggccatggcgggcgc	U26425	Human phospholipase C-beta-3 (PLCB3) gene, complete cds.
cggcggggtttccgcatgggccggac	U26446	Human protoporphyrinogen oxidase mRNA, complete cds.
gtggtggagttattgatgacgttaca	U26455	Human phosphatidylinositol 3-kinase homolog (ATM) mRNA, complete
cttcaaaaaccaaaaatgaggttcac	U26553	Human calcitonin receptor mRNA, complete cds.
tgaggacgaaagaagatgatggatgc	U26554	Human calcitonin receptor isoform mRNA, complete cds.
ccttccaaggccaagatgttcataaa	U26555	Human versican V2 core protein precursor splice-variant mRNA,
ctctccttagcctccatgttgactac	U26556	Human ferritin H (FTHL13) pseudogene.
tcttctggcgccaaaatgtcgttcgt	U26559	Human DNA mismatch repair (hMLH1) gene, 5' flanking region, partial
gaagaagaagaaaacatgtcaggaca	U26591	Human clone IS10 diabetes mellitus type I autoantigen (ICAp69)
gaagaagaagaaaacatgtcaggaca	U26592	Human clone IS4 diabetes mellitus type I autoantigen (ICAp69) mRNA,
gaagaagaagaaaacatgtcaggaca	U26593	Human clone 61.1 diabetes mellitus type I autoantigen (ICAp69)
gcgcgcgtggccgccatggcgcggaa	U26596	Human ribosomal protein L23-related mRNA, complete cds.
gaaggccccgacaccatgtcctgccg	U26648	Homo sapiens syntaxin 5 mRNA, complete cds.
gaactaaaattccagatggcaaactc	U26710	Human cbl-b mRNA, complete cds.
gaactaaaattccagatggcaaactc	U26711	Human cbl-b truncated form 1 lacking leucine zipper mRNA, complete
gaactaaaattccagatggcaaactc	U26712	Human cbl-b truncated form 2 lacking leucine zipper mRNA, complete
tcgggaaagtcaggcatggatgctgc	U26724	Homo sapiens calpastatin (BS-17) mRNA, complete cds.
cagcccgctggcgccatggagcgctg	U26726	Human 11-beta-hydroxysteroid dehydrogenase type 2 mRNA, complete
ggaggcggcgagaacatggtgcgcag	U26727	Human p16INK4/MTS1 mRNA, complete cds.
tcattgaattttagaatgattgaaga	U26742	Human dystrobrevin-delta mRNA, complete cds.
gaacctttgcaccccatgttcccaga	U26743	Human dystrobrevin-zeta mRNA, complete cds.
tcattgaattttagaatgattgaaga	U26744	Human dystrobrevin-gamma mRNA, complete cds.
ccctatgactgctccatggagcccat	U26914	Human ras-responsive element binding protein (RREB-1) mRNA,
cttcaaactactgagatgaagggggc	U27109	Human prepromultimerin mRNA, complete cds.
gggagagaggccgagatggcagatga	U27143	Human protein kinase C inhibitor-I cDNA, complete cds.
aactttcctgcgtccatgcagccccg	U27185	Human RAR-responsive (TIG1) mRNA, complete cds.
acccattgccccaccatggctgggga	U27193	Human protein-tyrosine phosphatase mRNA, complete cds.
tatcaacagagctgaatgagtgccag	U27203	Homo sapiens retinal dystrophin (DMD) gene, retinal dystrophin exon
ccagccagtccagcaatgatggaaaa	U27266	Human myosin binding protein H (MyBP-H) gene, complete cds.
ctgcctctcagcaggatggacgtgat	U27313	Human MYF-5 (myf-5) gene, promoter region and partial cds.
cagggctccggagccatgtggcccaa	U27325	Human thromboxane A2 receptor mRNA, complete cds.
aagatactctgacccatggatcccct	U27326	Human alpha (1,3/1,4) fucosyltransferase (FUT3) mRNA, major
aagatactctgacccatggatcccct	U27327	Human alpha (1,3/1,4) fucosyltransferase (FUT3) mRNA, major
aagatactctgacccatggatcccct	U27328	Human alpha (1,3/1,4) fucosyltransferase (FUT3) mRNA, minor
tagctactctgacccatggatcccct	U27329	Human alpha (1,3) fucosyltransferase (FUT5) mRNA, minor transcript
tagctactctgacccatggatcccct	U27330	Human alpha (1,3) fucosyltransferase (FUT5) mRNA, minor transcript
cagagactctgacccatggatcccct	U27333	Human alpha (1,3) fucosyltransferase (FUT6) mRNA, major transcript
cagagactctgacccatggatcccct	U27334	Human alpha (1,3) fucosyltransferase (FUT6) mRNA, major transcript
cagagactctgacccatggatcccct	U27335	Human alpha (1,3) fucosyltransferase (FUT6) mRNA, minor transcript
cagagactctgacccatggatcccct	U27336	Human alpha (1,3) fucosyltransferase (FUT6) mRNA, minor transcript
cagagactctgacccatggatcccct	U27337	Human alpha (1,3) fucosyltransferase (FUT6) mRNA, minor transcript
aaaaggttggcaacaatgagtaaacc	U27459	Human origin recognition complex protein 2 homolog hORC2L mRNA,
gatcttagcaaagcaatgtctcaaga	U27460	Human uridine diphosphoglucose pyrophosphorylase mRNA, complete
tccaccaggcagaagatgacagactg	U27467	Human Bcl-2 related (Bfl-1) mRNA, complete cds.
tgctgacatttcaatatgaagggcaa	U27478	Homo sapiens angiotensin II type 2 receptor (AT2) gene, partial
tcaaccagaatcaagatgtctgggac	U27516	Human recombination protein RAD52 mRNA, complete cds.
gctgtacaatagtggatgtttgagac	U27655	Human RGP3 mRNA, complete cds.
acccaccacacagccatggacgggaa	U27699	Human pephBGT-1 betaine-GABA transporter mRNA, complete cds.
aagctgttaaataagatgtgcaaagg	U27768	Human RGP4 mRNA, complete cds.
cagaggctgttccctatggcagaagg	U28014	Human cysteine protease (ICErel-II) mRNA, complete cds.
aagaattttgaagctatgttcaaagg	U28015	Human cysteine protease (ICErel-III) mRNA, complete cds.
gccgccgccgccgcaatgggcaaaac	U28042	Human DEAD box RNA helicase-like protein mRNA, complete cds.
ctgacggccagcgccatggcttacca	U28049	Human TBX2 (TXB2) mRNA, complete cds.
agcgctcgccattgaatgacttccag	U28054	Homo sapiens hepatocyte growth factor-like protein homolog gene,
gcccccctcgatcggatggggaagcc	U28164	Homo sapiens spermatogenesis associated PD1 mRNA, complete cds.
caagagctcaggaacatggagctgat	U28169	Human clone hast4v aryl sulfotransferase mRNA, complete cds.
caagagctcaggaacatggagctgat	U28170	Human clone hast4 aryl sulfotransferase mRNA, complete cds.
ggccagcgctctgacatgcagaaggt	U28249	Human 11kd protein mRNA, complete cds.
gaacgtgcgggcaccatgcgtcccca	U28281	Human secretin receptor mRNA, complete cds.
tcctcagctagtgacatggtcgatat	U28282	Human zinc finger protein (ZNF741) mRNA, complete cds.
cgcagggcgcgcgcgatgaaggcggt	U28368	Human Id-related helix-loop-helix protein Id4 mRNA, complete cds.
ccctgagctgctgagatggggcgggc	U28369	Homo sapiens semaphorin V mRNA, complete cds.
ctttgtctcataaccatgtccaccaa	U28386	Human nuclear localization sequence receptor hSRP1alpha mRNA,
tcgggtcgcggcaggatggttgcctc	U28387	Human hexokinase II pseudogene, complete cds.
cgagctccgtgctgcatggaacggct	U28389	Human dematin 52 kDa subunit mRNA, complete cds.
gtgtgaggacacgatatgctggggtt	U28413	Human Cockayne syndrome complementation group A CSA protein (CSA)
tcgcgagcctcggacatggtggcccc	U28424	Human protein kinase inhibitor p58 mRNA, complete cds.
ttttgaagtttagcaatggcgtcttt	U28488	Human putative G protein-coupled receptor (AZ3B) mRNA, complete
aggacttgaactgccatgtcctctga	U28686	Human putative RNA binding protein RNPL mRNA, complete cds.
gaggccagggtgaacatgccagctaa	U28687	Human zinc finger containing protein ZNF157 (ZNF157) mRNA, complete
acagggagaagtgaaatgacaacctc	U28694	Human eosinophil CC chemokine receptor 3 mRNA, complete cds.
gggggaacgtcggacatgcggctctg	U28727	Human pregnancy-associated plasma protein-A preproform (PAPPA)
gcggcgggaggcaggatgagcgcacg	U28749	Human high-mobility group phosphoprotein isoform I-C (HMGIC) mRNA,
cgccgcggactcaagatggcggcgtg	U28811	Human cysteine-rich fibroblast growth factor receptor (CFR-1) mRNA,
ccactgtgaaacagaatggtgtatgc	U28833	Homo sapiens Down syndrome candidate region protein (DSCR1) mRNA,
gagctcgcagggaccatgtatcagag	U28835	Human GATA-4 gene, partial cds.
ccgccggtcgccggcatgacgggccg	U28838	Human transcription factor TFIIIB 90 kDa subunit (hTFIIIB90) mRNA,
caccacctccctaccatggacccccg	U28918	Human progesterone receptor-associated p48 protein mRNA, complete
gaggggcgcgcggagatggcagcgtc	U28926	Human beta2-chimaerin mRNA, complete cds.
cgccaggccttcaccatggatcagtt	U28934	Human beta chemokine receptor-like 1 mRNA, complete cds.
tttccttgtaggcaaatgtgcaatac	U28935	Human p53-associated mdm2 protein (mdm2) gene, partial cds.
ttgccggctgtcggtatgtcgcgaca	U28946	Human G/T mismatch binding protein (GTBP) mRNA, complete cds.
gcccacggcagcaccatgcccgcact	U28963	Human Gps2 (GPS2) mRNA, complete cds.
acagaacatccagtcatggataaaaa	U28964	Homo sapiens 14-3-3 protein mRNA, complete cds.
cagaggctgttccctatggcagaagg	U28976	Human apoptotic cysteine protease Mih1/TX isoform alpha (mih1/Tx)
aaaagaaatattacgatgctaaaact	U28977	Human apoptotic cysteine protease Mih1/TX isoform beta (mih1/Tx)
gacaaagttcgggtcatggcagactc	U28978	Human apoptotic cysteine protease Mih1/TX isoform gamma (mih1/Tx)
gcagctcatccgaatatggaggctgg	U28979	Human apoptotic cysteine protease Mih1/TX isoform delta (mih1/Tx)
tgcatcacctggatcatgaggtcacc	U29089	Human proline- arginine-rich end leucine-rich repeat protein PRELP
cgagggactttgaacatgtcggggat	U29092	Homo sapiens ubiquitin conjugating enzyme mRNA, complete cds.
atctgccaggaaagaatgctgctagc	U29106	Human steroidogenic acute regulatory protein (StAR) pseudogene.
ggggaccgattcaccatggagggcgc	U29165	Human MOP1 mRNA, complete cds.
cgggccgccgccgccatggagctgag	U29171	Human casein kinase I delta mRNA, complete cds.
gcagctcccgtgaagatgtccactcc	U29175	Human transcriptional activator (BRG1) mRNA, complete cds.
tgcagagcagtcattatggcgaacct	U29185	Homo sapiens prion protein (PrP) gene, complete cds.
tcgccccgcaggaccatggccaacct	U29200	Human nucleoside diphosphate kinase B (nm23-H2) gene, 5'-region and
aagccaggagtcaaaatgactgagcg	U29332	Homo sapiens heart protein (FHL-2) mRNA, complete cds.
gagctggccgtcaacatgtcctttcc	U29343	Homo sapiens hyaluronan receptor (RHAMM) mRNA, complete cds.
ctcaccagagcagccatggaggaggt	U29344	Human breast carcinoma fatty acid synthase mRNA, complete cds.
gcagacccaccctccatgaagccccc	U29366	Human thimet oligopeptidase (THOP1) mRNA, complete cds.
gcagacccaccctccatgaagccccc	U29367	Human thimet oligopeptidase (THOP1) gene, 5' region and exon 1.
tacaaggtgggcaccatggcggagaa	U29538	Human heart protein with four and a half LIM domains (FHL-1) mRNA,
ctaaaaatagcaaagatgcttttgag	U29584	Human interferon alpha-beta receptor, beta subunit long form mRNA,
tgtcagagagtcacaatgaccttgca	U29589	Human m3 muscarinic acetylcholine receptor (CHRM3) gene, complete
tctctctcgggcaacatggcgggcgt	U29607	Human methionine aminopeptidase mRNA, complete cds.
tcccgcaccgccatcatgatctgcct	U29656	Human DR-nm23 mRNA, complete cds.
tccaccaggcagaagatgacagactg	U29680	Human A1 protein mRNA, complete cds.
ccatcctccagcaagatgctagggtc	U29700	Human anti-mullerian hormone type II receptor precursor gene,
agtagccaagacaccatggccgagcc	U29725	Human BMK1 alpha kinase mRNA, complete cds.
ctttgaacaaacaccatggccgagcc	U29726	Human BMK1 beta kinase mRNA, complete cds.
aggcgcggggacaccatggccgagcc	U29727	Human BMK1 gamma kinase mRNA, complete cds.
gggcccccggccgaaatgacagtgct	U29874	Human Flt3 ligand gene and Flt3 ligand alternatively spliced
tgactaagatcaatcatggtaagtgc	U29895	Human 4-hydroxyphenylpyruvate-dioxygenase gene, complete cds.
aaggtaattgctgccatggaaacaca	U29943	Human ELAV-like neuronal protein-2 Hel-N2 mRNA, complete cds.
cttgcaggccccaggatgcaggccct	U29953	Human pigment epithelium-derived factor gene, complete cds.
cgcggccgcctcagcatgtcggactt	X64044	H.sapiens mmRNA for large subunit of splicing factor U2AF.
acgggaggctgcaggatggtcaagct	X13482	Human mRNA for U2 snRNP-specific A' protein.
ttgcagggcagtggcatggagcccct	U30185	Human orphan opioid receptor mRNA, complete cds.
gggggtcgggcagctatggagccgcg	U30246	Human bumetanide-sensitive Na-K-Cl cotransporter (NKCC1) mRNA,
tgcaccggcagcaccatgtcgctcat	U30274	Human KIR (cl-11) NK receptor precursor protein mRNA, complete cds.
ccttaggataagaccatggccttgag	U30313	Human diadenosine tetraphosphatase mRNA, complete cds.
tcccgggccgcagccatgaacggcga	U30329	Human insulin promoter factor 1 (IPF1) mRNA, complete cds.
gggaaaaagaaagaaatgggaaacag	U30473	Homo sapiens src-like adapter protein (SLAP) mRNA, complete cds.
ggggacggcagcaccatggacccccg	U30498	Human retinoic acid-inducible E3 protein mRNA, complete cds.
tgatcatcggatatcatggagtctgg	U30504	Human transcription initiation factor TFIID subunit TAFII31 mRNA,
actaagattctcaaaatggtttatta	U30521	Human P311 HUM (3.1) mRNA, complete cds.
ggaacataatttctcatggcagtgtt	U30610	Human CD94 protein mRNA, complete cds.
tacagacagctgaccatggaagcgaa	U30787 X06048	Human uroporphyrinogen decarboxylase (URO-D) gene, complete cds.
cgtcgggcggtgcggatgtcgggctg	U30825	Human splicing factor SRp30c mRNA, complete cds.
tactagccggacatcatgagtggctg	U30826	Human splicing factor SRp40-1 (SRp40) mRNA, complete cds.
tactagccggacatcatgagtggctg	U30827	Human splicing factor SRp40-3 (SRp40) mRNA, complete cds.
ccgcccgccacggacatgccgcgcgt	U30828	Human splicing factor SRp55-2 (SRp55) mRNA, complete cds.
ccgcccgccacggacatgccgcgcgt	U30829	Human splicing factor SRp55-3 (SRp55) mRNA, partial cds.
agaaggcagaacaaaatgagctgggc	U30872	Human mitosin mRNA, complete cds.
ccgcccgccacggacatgccgcgcgt	U30883	Human splicing factor SRp55-1 (SRp-55) mRNA, complete cds.
tactagccggacatcatgagtggctg	U30884	Human splicing factor SRp40-2 (SRp40) mRNA, complete cds.
ccgccgcgccccgccatgccgctcta	U30888	Human tRNA-guanine transglycosylase mRNA, complete cds.
agaccacctgccgtgatgctgaagtt	U30891	Human pyruvate carboxylase precursor, mRNA, nuclear gene encoding
gttgttattacagctatgaagtctta	U30930	Human UDP-Galactose ceramide galactosyl transferase (CGT) mRNA,
ccttcatgggccgcgatgatggcggc	U31110	Human alternatively spliced trp-1 protein and unspliced trp-1
ggcgggcgcgggaagatggcggcagc	U31116	Human beta-sarcoglycan A3b mRNA, complete cds.
ttggcactgggcctcatggcgctttt	U31120	Human interleukin-13 (IL-13) precursor gene, complete cds.
gacttcaagacgtggatgcggacgca	U31176	Homo sapiens ERV1 (ERV1) mRNA, complete cds.
gcgcgcgccagaggcatggagcgctg	U31202	Human noggin (NOGGIN) gene, complete cds.
taggatcgtcccgctatgatggaagt	U31214	Human (nmc) mRNA, partial cds.
ctcgtcctcaccaccatggtcgggct	U31215	Human metabotropic glutamate receptor 1 alpha (mGluR1alpha) mRNA,
ctcctgacgcccaaaatggcagctaa	U31248	Human zinc finger protein (ZNF174) mRNA, complete cds.
tttgtgtccctggccatggcgctgca	U31278	Homo sapiens mitotic feedback control protein Madp2 homolog mRNA,
ctgctcccgcacgccatgaagtcgcc	U31332	Human DP prostanoid receptor (PTGDR) gene, 5' region and partial
agcaggggcagtagaatgaaagaggg	U31382	Human G protein gamma-4 subunit mRNA, complete cds.
cccagcgccgccgccatgtcctccgg	U31383	Human G protein gamma-10 subunit mRNA, complete cds.
ggttctggggcgaaaatgcctgccct	U31384	Human G protein gamma-11 subunit mRNA, complete cds.
ggcaccggcagcaccatgttgctcat	U31416	Homo sapiens killer cell Ig-like receptor (KIR3DL1) mRNA, complete
tcgtaccaccccagaatgtgcactgg	U31449	Human intestinal and liver tetraspan membrane protein (il-TMP)
ctaccgagcgcgtctatgagcgcagc	U31468	Homo sapiens homeobox protein (GBX2) gene, complete cds.
ggcggtggcggcgccatgggcggcct	U31501	Human fragile X mental retardation syndrome related protein (FXR2)
tgtaaagccatagagatggcctgtcc	U31511	Human inducible nitric oxide synthase (NOS) mRNA, complete cds.
cagcactctgcagaaatgcctcctca	U31519	Human phosphoenolpyruvate carboxykinase (PCK1) gene, promoter
gcacccggcagcaccatgacagatca	U31525	Human glycogenin mRNA, complete cds.
cggggccgggacgcgatggcggcggc	U31556	Human transcription factor E2F-5 mRNA, complete cds.
aggcaagttgcactcatggcacctcc	U31601	Human tyrosine protein kinase (Jak3B) splice variant mRNA, complete
tgtggagctgccgccatggccccgcg	U31628	Human interleukin-15 receptor alpha chain precursor (IL15RA) mRNA,
aagagggactccagaatggctgagga	U31659	Human TBP-associated factor TAFII80 mRNA, complete cds.
ggacaggcagccaccatgagcctcag	U31760	Human cGMP-phosphodiesterase beta-subunit gene, partial cds.
accattcttggaaccatggcggcagt	U31767	Human neuronatin alpha and neuronatin beta genes, complete cds.
gtggccggggagcccatggcgtacag	U31814	Human transcriptional regulator homolog RPD3 mRNA, complete cds.
tagataaacttcggcatggcgggtta	U31850	Human dystonin isoform 1 mRNA, partial cds.
cagacaccaaccactatgctgtcagc	U31875	Human Hep27 protein mRNA, complete cds.
cgagggactttgaacatgtcggggat	U31882	Human ubiquitin-conjugating enzyme 9 mRNA, complete cds.
gggtgggggggaaagatggcggagct	U31903	Human CREB-RP (creb-rp) mRNA, complete cds.
agagaatctgaagggatgatggatgc	U31905	Human prostate-specific transglutaminase (hTGP) mRNA, complete cds.
cagcggttgcgaagaatggaacgaag	U31906	Homo sapiens golgin-245 mRNA, complete cds.
cgggcgccgcgggccatggcgggcca	U31929	Human orphan nuclear receptor (DAX1) gene, complete cds.
ccttctggctctgccatgccctgctc	U31930	Human deoxyuridine nucleotidohydrolase mRNA, complete cds.
cgagggactttgaacatgtcggggat	U31933	Human ubiquitin conjugating enzyme homolog mRNA, complete cds.
aaagcaagccacaccatgggtgagat	U31973	Human phosphodiesterase A' subunit (PDE6C) mRNA, complete cds.
cagtcttccaggattatggagtttct	U31986	Human cartilage-specific homeodomain protein Cart-1 mRNA, complete
cgcctgggcttcaggatgaaggaccg	U32315	Human syntaxin 3 mRNA, complete cds.
tacctctccccacagatgagcagcag	U32323	Human interleukin-11 receptor alpha chain gene, complete cds.
gctgggatcaccgagatgagcagcag	U32324	Human interleukin-11 receptor alpha chain mRNA, complete cds.
ccacaggaatacctaatgcctttttt	U32331	Homo sapiens RIG mRNA, complete cds.
tccttatttactgcaatgttctttgc	U32376	Human channel associated protein of synapse (chapsyn-110) mRNA,
ggacctgtactgaaaatgggtccaat	U32500	Human type 2 neuropeptide Y receptor mRNA, complete cds.
gaattgaccaaagcaatggtgatgga	U32519	Human GAP SH3 binding protein mRNA, complete cds.
cttcctgcgccagccatgcctttaaa	U32573	Homo sapiens UDP glucose:glycogen 4-alpha-D- glycosytransferase
acggaacccccagaaatgtccctcct	U32576	Human apolipoprotein apoC-IV (APOC4) gene, complete cds.
tacacgttagaaagtatgctgcatga	U32581	Homo sapiens lambda/iota protein kinase C-interacting protein mRNA,
ctctgaaaagacagcatggctattac	U32645	Human myeloid elf-1 like factor (MEF) mRNA, complete cds.
ttggaagaaacaacgatgactcctgg	U32659	Human IL-17 mRNA, complete cds.
tttgaacaggtggccatggcctcatc	U32672	Human orphan receptor GPR10 (GPR10) gene, complete cds.
cctgaacttgatgcgatgggaggctg	U32680	Homo sapiens CLN3 protein (CLN3) mRNA, complete cds.
gcggaccgggggatcatggaagctga	U32849	Homo sapiens Nmi mRNA, complete cds.
cagctggatgtcaggatgcgtgtggt	U32907	Human p37NB mRNA, complete cds.
ttctccacggtaaccatgtgcgaccg	U32944	Human cytoplasmic dynein light chain 1 (hdlc1) mRNA, complete cds.
tattttcaagagaagatgacttttaa	U32974	Human IAP-like protein ILP mRNA, complete cds.
gctccaagcctcgacatgtcgtacaa	U32986	Human xeroderma pigmentosum group E UV-damaged DNA binding factor
cagtgccttttcaccatgagtgggtg	U32989	Human tryptophan oxygenase (TDO) mRNA, complete cds.
tctcctcattggctgatggatcccaa	U33017	Human signaling lymphocytic activation molecule (SLAM) mRNA,
gggcggcaggaggacatggccagcga	U33053	Human lipid-activated protein kinase PRK1 mRNA, complete cds.
cggcggcgccaggacatggagctcga	U33054	Human G protein-coupled receptor kinase GRK4 mRNA, alpha splice
cggcggcgccaggacatggagctcga	U33055	Human G protein-coupled receptor kinase GRK4 mRNA, beta splice
cggcggcgccaggacatggagctcga	U33056	Human G protein-coupled receptor kinase GRK4 mRNA, gamma splice
agcagcagcctcaccatgaagttgct	U33147	Human mammaglobin mRNA, complete cds.
attcaagttttcaagatgaagttttt	U33267	Human glycine receptor beta subunit (GLRB) mRNA, complete cds.
ctgctgcctgagaggatgtctggggt	U33284	Human protein tyrosine kinase PYK2 mRNA, complete cds.
cgagatcctatagcaatggaactcag	U33286	Human chromosome segregation gene homolog CAS mRNA, complete cds.
ccagcgaccctagccatgagaaccct	U33317	Human defensin 6 (HD-6) gene, complete cds.
ggcaccggcagcaccatgttgctcat	U33328	Homo sapiens killer cell Ig-like receptor variant (KIR3DL1) mRNA,
ctgcctggggaagcaatgcaagtctc	U33428	Human K+ channel beta 1a subunit mRNA, alternatively spliced,
agtgaggctggctccatgtatccaga	U33429	human K+ channel beta 2 subunit mRNA, complete cds.
cccttgtcctgggccatggcccagaa	U33446	Human prostasin gene, complete cds.
gactccagccaaagcatgaatggcct	U33447	Human putative G-protein-coupled receptor (GPR17) gene, complete
agcctaggtgtgtccatggcgtcagg	U33448	Human putative G-protein-coupled receptor (GPR16) gene, complete
aaacggacctggaggatgttgatctc	U33460	Human DNA-directed RNA polymerase I largest subunit mRNA, complete
gcgcagcgaagcccgatgtggtccgg	U33627	Human thyroid transcription factor-1 (TTF-1) gene, partial cds.
gcggcggtggagaagatgctgcagtc	U33632	Human two P-domain K+ channel TWIK-1 mRNA, complete cds.
cctgagcccgccgcgatgggagctgc	U33635	Human colon carcinoma kinase-4 (CCK4) mRNA, complete cds.
agccgccgccgaatcatgtcgatgag	U33749	Human thyroid transcription factor-1 (TTF-1) mRNA, complete cds.
ttaacaccgaacaccatgccttcaat	U33760	Human cyclin A/CDK2-associated p19 (Skp1) mRNA, complete cds.
agctctgcaagtttaatgcacgtatt	U33761	Human cyclin A/CDK2-associated p45 (Skp2) mRNA, complete cds.
gtggggggcggggagatgaacgctgc	U33818	Human inducible poly(A)-binding protein mRNA, complete cds.
tccactggattcacaatgacatcctt	U33821	Homo sapiens tax1-binding protein TXBP151 mRNA, complete cds.
atcgcgaaagcaaccatggaagacct	U33822	Human tax1-binding protein TXBP181 mRNA, complete cds.
tatttgcaaaggtccatggctaatga	U33833	Human CHL1-related helicase (CHLR1) mRNA, complete cds.
gggaccgtcgcggagatggatcgcgg	U33837	Human glycoprotein receptor gp330 precursor, mRNA, complete cds.
ctgaaattgtgaaccatgagtctagt	U33841	Human ataxia telangiectasia (ATM) mRNA, complete cds.
cagtccactgctctgatgccgaaggg	U33849	Human lymphoma proprotein convertase (LPC) mRNA, complete cds.
ccctgacgcaggaacatggagctgat	U33886	Human arylamine sulfotransferase (STP2) gene, complete cds.
taggcccctcccacaatgcttgtcgc	U33920	Human clone lambda 5 semaphorin mRNA, complete cds.
aatattctctttggaatggggaatcc	U33936	Human adenosine kinase mRNA, complete cds.
ggggcttccaggaggatgcggagccc	U34038	Human proteinase-activated receptor-2 mRNA, complete cds.
cggggcccaagaaccatgtctacgcg	U34044	Human selenium donor protein (selD) mRNA, complete cds.
tcggagcccggctggatgttacaggc	U34046	Human transcription factor PU.1 (Spi-1) gene, promoter region and
gccccgctctgcaggatgggcacagt	U34051	Human cyclin-dependent kinase 5 activator isoform p39i mRNA,
aactctaactcccccatggagtcggc	U34070	Human CCAAT/enhancer binding protein alpha gene, complete cds.
cttcaagcctccaggatggcaatcca	U34074	Human A kinase anchor protein S-AKAP84 mRNA, nuclear gene encoding
tcctgacttgggaccatggtgattct	U34227	Human myosin-VIIa mRNA, partial cds.
ggggaaggcaccgtgatgcccgcaac	U34249	Human putative zinc finger protein (ZNFB7) mRNA, complete cds.
tctcctgtcgccgccatgagcactgg	U34252	Human gamma-aminobutyraldehyde dehydrogenase mRNA, complete cds.
aacccagggagcgcgatgggctgcag	U34279	Human uroguanylin mRNA, complete cds.
atcgttccatttacaatggcgcagag	U34304	Human nonmuscle myosin heavy chain IIB mRNA, partial cds.
atactactgaaatgaatgggcaaaaa	U34343	Human 13kD differentiation-associated protein mRNA, partial cds.
tccagaggcagggctatgctcacatt	U34349	Human seven trans-membrane domain protein (AD3LP/AD5) mRNA,
aggcagaaggaacccatggctttagc	U34355	Human skeletal muscle insulin receptor binding protein (Grb-IR)
ctgacacctcccaccatggacagctt	U34360	Human lymphoid nuclear protein (LAF-4) mRNA, complete cds.
gccgccagaggagaaatgtctgaagt	U34584	Human Bcl-2 interacting killer (BIK) mRNA, complete cds.
cagagcgctgccatcatgagtgaaat	U34605	Human retinoic acid- and interferon-inducible 58K protein RI58
gagacagctccagacatgtggctctt	U34623	Human T cell surface glycoprotein CD-6 mRNA, complete cds.
gagacagctccagacatgtggctctt	U34624	Human T cell surface glycoprotein CD-6 mRNA, complete cds.
gagacagctccagacatgtggctctt	U34625	Human T cell surface glycoprotein CD-6 mRNA, complete cds.
cgaactagtgttgggatggccaccaa	U34683	Human glutathione synthetase mRNA, complete cds.
tctctcggcagcagaatgagccggca	U34690	Human coronin-like protein (HCORO1) mRNA, complete cds.
tcaggtgggtgagaaatgggcgactg	U34802	Homo sapiens gap junction membrane channel protein alpha-8 (GJA8)
ccctgacgcaggaacatggagctgat	U34804	Human thermostable phenol sulfotransferase (STP2) gene, partial
atctgctctttggtgatggacccaga	U34806	Human G protein-coupled receptor (GPR15) gene, complete cds.
caagctgtggtatttatgagcctcca	U34819	Human JNK3 alpha2 protein kinase (JNK3A2) mRNA, complete cds.
caagctgtggtatttatgagcctcca	U34820	Human JNK3 alpha1 protein kinase (JNK3A1) mRNA, complete cds.
gcaggacgctgcatcatgagcgacag	U34821	Human JNK2 alpha1 protein kinase (JNK2A1) mRNA, complete cds.
accagagagaacatcatggtggcttt	U34844	Human mercurial-insensitive water-channel gene, 5' region and
accagagagaacatcatggtggcttt	U34845	Human mercurial-insensitive water channel mRNA, form 1, complete
ctctggtccacatggatgaggaaaaa	U34846 U33013	Human mercurial-insensitive water channel mRNA, form 2, complete
aaggaagagaccaagatgaatacaga	U34877	Homo sapiens biliverdin-IX alpha reductase mRNA, complete cds.
ccccacagtctcaccatggcccgcac	U34879	Human 17-beta-hydroxysteroid dehydrogenase (EDH17B2) gene, complete
aaggtggccttgcaaatgccggaagg	U34880	Homo sapiens DPH2L mRNA, complete cds.
gtggtgtccagcaacatggaggccac	U34919	Human white homolog (white) mRNA, complete cds.
actggcgctgccaccatgttccccag	U34962	Human transcription factor HCSX (hCsx) mRNA, complete cds.
ttcttaatatctaagatggtgcgtga	U34976	Human gamma-sarcoglycan mRNA, complete cds.
gcgggactcggcggcatggcgggctc	U34994	Homo sapiens DNA dependent protein kinase catalytic subunit (PRKDC)
gcaggacgctgcatcatgagcgacag	U35002	Human JNK2 beta1 protein kinase (JNK2B1) mRNA, complete cds.
gcaggacgctgcatcatgagcgacag	U35003	Human JNK2 beta2 protein kinase (JNK2B2) mRNA, complete cds.
taattgcttgccatcatgagcagaag	U35004	Human JNK1 beta1 protein kinase (JNK1B1) mRNA, complete cds.
tttggctgcaattgcatgaaatccca	U35048	Human TSC-22 protein mRNA, complete cds.
accagagccggcggcatggacttcgt	U35100	Human complexin II mRNA, complete cds.
gccgccggcccggacatggccgccaa	U35113	Human metastasis-associated mta1 mRNA, complete cds.
gctgctgccggtgtcatggcggagct	U35116	Human ubiquitin isopeptidase T mRNA, complete cds.
aatgttggaccccaaatgattataag	U35117	Human transcription factor Dp-2 mRNA, partial cds.
ccagacggcgcagacatgtcagaaca	U35139	Human NECDIN related protein mRNA, complete cds.
acgacccgacgcaagatggcgagtaa	U35143	Human retinoblastoma-binding protein (RbAp46) mRNA, complete cds.
ggactttaaattaaaatggaaaaata	U35146	Homo sapiens p56 KKIAMRE protein kinase (KKIAMRE) mRNA, complete
cttttcacatccactatgaacacctc	U35232	Human neuropeptide Y4 receptor protein gene, complete cds.
aggtcgctgccaagcatggcgcccac	U35234	Human protein tyrosine phosphatase sigma mRNA, complete cds.
tgtcaattcgccgccatgaacgtggt	U35246	Human vacuolar protein sorting homolog h-vps45 mRNA, complete cds.
ttgcaggcgggaaccatgtctcaggc	U35340	Human beta B1-crystallin mRNA, complete cds.
cctggaagcctagaaatgggaccatt	U35376	Human repressor transcriptional factor (ZNF85) mRNA, complete cds.
ccttcaggcccaaagatggggaacat	U35398	Human G protein-coupled receptor mRNA, complete cds.
gccgaagtgcccaccatgggcaacca	U35399	Human G protein-coupled receptor mRNA, complete cds.
aagctggcgggcactatggggaaaaa	U35451	Homo sapiens heterochromatin protein p25 mRNA, complete cds.
caaagaacatccaccatgcagctctt	U35464	Human protein C inhibitor (PCI-B) mRNA, complete cds.
cgcctggtgggcagcatgtcggcaac	AJ001340	Homo sapiens mRNA for U3 snoRNP associated 55 kDa protein.
ccgggcccaggcgcgatggtgcagca	U35612	Homo sapiens SOX22 protein (SOX22) mRNA, complete cds.
gaggaaggagagaaaatggcgtccac	U35622	Homo sapiens EWS protein/E1A enhancer binding protein chimera mRNA,
gaggaagagatagccatggaggacag	U35735	Human RACH1 (RACH1) mRNA, complete cds.
cgtggttgtcccgccatggcactgtc	U35832	Human anthracycline-associated resistance ARX mRNA, complete cds.
gactgatctgccgccatgattggagg	U36188	Human clathrin assembly protein 50 (AP50) mRNA, complete cds.
actaagattctcaaaatggtgtatta	U36189	Human p311 protein (hP311) mRNA, complete cds.
ccgggcgcaccgaccatggcctccaa	U36190	Human cysteine-rich protein 2 (hCRP2) mRNA, complete cds.
tgcatgcctcaccttatggaaaggat	U36221	Human pancreatic zymogen granule membrane protein GP-2 mRNA,
ggacctgtactgaaaatgggtccaat	U36269	Human neuropeptide Y/peptide YY Y2 receptor mRNA, complete cds.
accatcccccctgccatgtgggaact	U36308	Homo sapiens lens major intrinsic protein (MIP) gene, complete cds.
tcgtcaggctaagaaatggcatttca	U36310	Human glycerol-3-phosphate dehydrogenase mRNA, nuclear gene
ctgctctgcggggtcatggtgtgctt	U36336	Human lysosome-associated membrane protein-2b (LAMP2) mRNA,
cagtcaatatgcaccatgtttaatgt	U36448	Human Ca2+-dependent activator protein for secretion mRNA, complete
tcctaggccaagctcatggcccagca	U36499	Human lymphoid-specific SP100 homolog (LYSP100-A) mRNA, complete
tcctaggccaagctcatggcccagca	U36500	Human lymphoid-specific SP100 homolog (LYSP100-B) mRNA, complete
gcctagggtgggaagatggcaggtgg	U36501	Human SP100-B (SP100-B) mRNA, complete cds.
gtctcggaggccaggatgcctgccct	U36600	Homo sapiens heparan N-deacetylase/N-sulfotransferase-1 mRNA,
cttcctccccccgccatgctccagtt	U36601	Homo sapiens heparan N-deacetylase/N-sulfotransferase-2 mRNA,
tagcgcggctcagccatgagcaacag	U36623	Human tyrosine phosphatase epsilon cytoplasmic isoform (PTPRE)
ccttccgagtgggccatggccggtac	U36759	Human pre-T cell receptor alpha-type chain precursor, mRNA,
cgcgtcaccgccgggatgaagccgat	U36764	Human TGF-beta receptor interacting protein 1 mRNA, complete cds.
acactgtttccagccatgggtttgtc	U36787	Human putative holocytochrome c-type synthetase mRNA, complete cds.
gcggcggcggccgggatgatgctgct	U36926	Human lanosterol 14-alpha-demethylase (CYP51P1) processed
gcccgggttggcgccatgtacgccgt	U37012	Human cleavage and polyadenylation specificity factor mRNA,
agcccaccggccagcatgtcctctgc	U37019	Homo sapiens smooth muscle cell calponin mRNA, complete cds.
tcccttgatctgagaatggctacctc	U37022	Human cyclin-dependent kinase 4 (CDK4) gene, complete cds.
cctccagccagaaggatggggtggct	U37055 M74179	Human hepatocyte growth factor-like protein gene, complete cds.
atttctgcaccaaccatggccacgtt	U37100	Homo sapiens aldose reductase-like peptide mRNA, complete cds.
gggcaccagccagccatggccacagc	U37106	Human erythroid Kruppel-like factor EKLF gene, complete cds.
ccacagacttaaaacatgagctcaga	U37122	Human adducin gamma subunit mRNA, complete cds.
ttcccgaatctcagaatgcctgttaa	U37139	Human beta 3-endonexin mRNA, long form and short form, complete
cataatctcttctagatggaggcatg	U37146	Human silencing mediator of retinoid and thyroid hormone action
cgccgccgctccgccatggggaagcg	U37219	Human cyclophilin-like protein CyP-60 mRNA, complete cds.
tgggcttttcacaaaatggcgccgaa	U37230	Human ribosomal protein L23a mRNA, complete cds.
aagcggatcgaagtgatggccctgcc	U37248	Homo sapiens alpha-mannosidase (6A8) mRNA, complete cds.
cctacaggaggaagaatggctgcagg	U37251	Human KRAB zinc finger protein (ZNF177) mRNA, splicing variant,
cctacaggaggaagaatggctgcagg	U37263	Human KRAB zinc finger protein (ZNF177) mRNA, complete cds.
aacaccatagacaatatgtcgctctt	U37283	Human microfibril-associated glycoprotein-2 MAGP-2 mRNA, complete
aaagcgggcagcaggatggtggtgga	U37352	Human protein phosphatase 2A B'alpha1 regulatory subunit mRNA,
tgactgaccataaaaatgagtactgc	U37359	Homo sapiens MRE11 homologue hMre11 mRNA, complete cds.
cgctcgcgcctctcgatgggcagctc	U37408	Homo sapiens phosphoprotein CtBP mRNA, complete cds.
ttggcggggaccgtcatggcgtcgca	U37426	Human kinesin-like spindle protein HKSP (HKSP) mRNA, complete cds.
accgccgtgggaacgatggcagatga	U37448	Human Mch3 isoform alpha (Mch3) mRNA, complete cds.
gatcagccttgtgggatggcagatga	U37449	Human Mch3 isoform beta (Mch3) mRNA, complete cds.
gactctgacaggatcatggctatgat	U37518	Human TNF-related apoptosis inducing ligand TRAIL mRNA, complete
aaccttcaggcctggatgaaggatga	U37519	Human aldehyde dehydrogenase (ALDH8) mRNA, complete cds.
gtcgcaaaatccaacatgaaaatcct	U37529	Human substance P beta-PPT-A mRNA, complete cds.
cccattcatttcattatgaacatagt	U37546	Human IAP homolog C (MIHC) mRNA, complete cds.
tactgtcacctactcatgcacaaaac	U37547	Human IAP homolog B (MIHB) mRNA, complete cds.
ttggaacagaaagaaatggatttatc	U37574	Human BRCA1 gene, partial cds.
atttccagctcagcgatgcccccagg	U37591	Human nmd mRNA, complete cds.
ctccctggccgccccatgtcggccgc	U37673	Human neuron-specific vesicle coat protein and cerebellar
cgtggccccctcgcgatggcgggcat	U37689	Human RNA polymerase II subunit (hsRPB8) mRNA, complete cds.
ggtgacaacgccagcatgccagtgct	U37707	Human dlg3 mRNA, complete cds.
tcgtctggtgggaccatgaactgcca	U37791	Homo sapiens clone rasi-1 matrix metalloproteinase RASI-1 mRNA,
tttttgaaaaatacaatgtctaatgg	U38175	Human HuR RNA binding protein (HuR) mRNA, complete cds.
agtgccctccccacaatggggcagat	U38226	Human testis-specific hexokinase 1 (hHK1-ta) mRNA, partial cds.
agtgccctccccacaatggggcagat	U38227	Human testis-specific hexokinase 1 (hHK1-tb) mRNA, partial cds.
agtgccctccccacaatggggcagat	U38228	Human testis-specific hexokinase 1 (hHK1-tc) mRNA, partial cds.
gaagaagaagaaaacatgtcaggaca	U38260	Human islet cell autoantigen ICAp69 mRNA, complete cds.
taggcccctcccacaatgcttgtcgc	U38276	Human semaphorin III family homolog mRNA, complete cds.
cccactctgcccaccatggacggcgt	U38291	Human microtubule-associated protein 1a (MAP1A) genomic sequence.
tagaacctaacctggatgcagctctc	U38320	Homo sapiens clone rasi-3 matrix metalloproteinase RASI-1 mRNA,
tcgtctggtgggaccatgaactgcca	U38321	Homo sapiens clone rasi-11 matrix metalloproteinase RASI-1 mRNA,
ctgaggcctggacaaatgggagtgac	U38322	Homo sapiens clone rasi-9 matrix metalloproteinase RASI-1 mRNA,
gccacaagggcccgcatgaggcagcc	U38431	Human clone rasi-6 matrix metalloproteinase RASI-1 mRNA, splice
aactgacgagtaaacatgtatggaaa	U38480	Human retinoid X receptor-gamma mRNA, complete cds.
ctgtccaaagttaacatgtcactgaa	U38545	Human ARF-activated phosphatidylcholine-specific phospholipase D1a
tcctatcagagcaacatgaattctgc	U38613	Human mariner transposon humar1pcr.
ccttatcaaagcaacatgaattctgc	U38614	Human mariner transposon humar1g2.
ccctattagaacaacataaattctgc	U38615	Human mariner transposon humar1g1.
actgagttcttcattatgtctgatgg	U38654	Homo sapiens Rab27a mRNA, complete cds.
ctcctgcacaagaacatgaaacacct	U38663	Human IgG anti-platelet GPIIb/IIIa antibody heavy chain (ha4g1)
gaagccaccgtcatcatgtctgacca	U38784	Human ubiquitin-like protein mRNA, complete cds.
cgagggactttgaacatgtcggggat	U38785	Human RAD6 homolog mRNA, complete cds.
ccaggacttcaagccatgtgggtctt	U38805	Homo sapiens fertilin beta mRNA, complete cds.
gatctctgccccaacatgattgcggc	U38810	Human mab-21 cell fate-determining protein homolog (CAGR1) mRNA,
ttcccatcggcgaagatggccctgga	U38817	Human SUPT4H mRNA, complete cds.
ttcccatcggcgaagatggccctgga	U38818	Human SUPT4H mRNA, complete cds.
ccagcaggtggggtcatgatcaaaca	U38864	Human zinc-finger protein C2H2-150 mRNA, complete cds.
gaacaacctgtgtgcatgctttttga	U38894	Human protein tyrosine kinase t-Ror1 (Ror1) mRNA, complete cds.
gacttcctggccaacatgaggtttct	U38904	Human zinc finger protein C2H2-25 mRNA, complete cds.
gcctgcggggcggagatgggcagggg	U38945	Human hypothetical 18.1 kDa protein (CDKN2A) mRNA, complete cds.
acctggtacatcggcatggcgcaacc	U38964	Human PMS2 related (hPMSR2) gene, complete cds.
ccgggcctggcccgtatgtgtccttg	U38979	Human PMS2 related (hPMSR3) gene, complete cds.
gcctgccttcttgccatgtctaacga	U39050	Human mitogen-responsive phosphoprotein (DOC-2) mRNA, complete cds.
gacctggagcctataatggaactggg	U39064	Human MAP kinase kinase 6 mRNA, complete cds.
aaaggaaaggggaaaatgtctcagtc	U39065	Human MAP kinase kinase 6b mRNA, complete cds.
cgcgtcacagccgggatgaagccgat	U39067	Homo sapiens translation initiation factor eIF3 p36 subunit mRNA,
aacaacatcccagctatggctggcga	U39195	Human clone KGP G-protein coupled inwardly rectifying potassium
tcgccccttcgtattatgtctgcact	U39196	Human clone hGIRK1 G-protein coupled inwardly rectifying potassium
tcctgacttgggaccatggtgattct	U39226 U17180	Human myosin VIIA (USH1B) mRNA, complete cds.
ttcgccgccctcacgatgactacctc	U39231	Human GIP receptor (GIPR) mRNA, complete cds.
tcaccgcatcacaccatggctctgaa	U39317	Human E2 ubiquitin conjugating enzyme UbcH5B (UBCH5B) mRNA,
cgacaagcacacactatggcgctgaa	U39318	Human E2 ubiquitin conjugating enzyme UbcH5C (UBCH5C) mRNA,
tagaaggggaaactgatgccaggaga	U39360	Homo sapiens DNA-binding protein (CROC-1A) mRNA, complete cds.
ctgccgctgctaaacatggcctacaa	U39361	Homo sapiens DNA-binding protein (CROC-1B) mRNA, complete cds.
gagggacacgcatgcatggggctggt	U39402	Human fetal brain (199G4) mRNA, complete cds.
ccctttgtggccgccatggacaattc	U39412	Homo sapiens alpha SNAP mRNA, complete cds.
cctcttcgtgggaaaatgaaccagaa	U39447	Human placenta copper monamine oxidase mRNA, complete cds.
ccccaacctgtgacaatgacagcaga	U39487	Human xanthine dehydrogenase/oxidase mRNA, complete cds.
tcgtcgcgcagggtgatggctcgcgc	U39550	Homo sapiens UDP-glucuronosyltransferase (UGT1J) gene, exon 1,
ggctgaagttctctgatggctcctgc	U39551	Human UDP-glucuronosyltransferase (UGT1K) pseudogene, exon 1,
ggctgaagttctctgatggcttctgc	U39552	Human UDP-glucuronosyltransferase (UGT1L) pseudogene, gene, exon 1,
ggctgaagttctctgatggctcgtgc	U39570	Human UDP-glucuronosyltransferase (UGT1G) gene, exon 1, partial
aggcactgggcagtgatgagggtcct	U39573	Human salivary peroxidase mRNA, complete cds.
ccagaagggtgggagatggcagtttt	U39576	Human butyrophilin precursor mRNA, complete cds.
aaaggaaaggggaaaatgtctcagtc	U39656	Human MAP kinase kinase 6 (MKK6) mRNA, complete cds.
aaaggaaaggggaaaatgtctcagtc	U39657	Human MAP kinase kinase 6 (MKK6) mRNA, complete cds.
ggcacgagcttcagcatgactactca	U39664	Homo sapiens Tiff66 mRNA, complete cds.
tttccttgtaggcaaatgtgcaatac	U39736	Human p53-associated protein (mdm2) gene, 5' end, and partial cds.
ctgcgtgcgaggattatggctgctgt	U39817	Human Bloom's syndrome protein (BLM) mRNA, complete cds.
cagggtggctccaggatgttaggaac	U39840	Human hepatocyte nuclear factor-3 alpha (HNF-3 alpha) mRNA,
agtccggccatcaccatgctccggac	U39905	Human vesicular monoamine transporter VMAT1 mRNA, complete cds.
gagacttcggcggacatggctcccag	U39945	Human adenylate kinase 2 (adk2) mRNA, complete cds.
gtgagggaaataacaatggagccagg	U40002	Human hormone-sensitive lipase testicular isoform mRNA, complete
gggacagcagccacaatgaggaactc	U40006	Human granzyme A gene, upstream sequence and partial cds.
aggcactttggaagaatgactctgga	U40038	Human GTP-binding protein alpha q subunit (GNAQ) mRNA, complete
gcggcggcggcggggatgatgttgct	U40053	Human lanosterol 14-alpha demethylase (CYP51P2) processed
ttggagccggaagccatggcacacta	U40152	Human origin recognition complex 1 (HsORC1) mRNA, complete cds.
agccctttaagccagatgatgaactt	U40215	Human synapsin IIb mRNA, complete cds.
atctccaggggggccatggccagtac	U40223	Human uridine nucleotide receptor (UNR) gene, complete cds.
aaaaggttggcaacaatgagtaaacc	U40268	Homo sapiens origin recognition complex 2 homolog (Orc2) mRNA,
cctgagcccgccgcgatgggagctgc	U40271	Homo sapiens transmembrane receptor precursor (PTK7) mRNA, complete
ctctcactttccgtcatggcgctgaa	U40272	Human NAD+-specific isocitrate dehydrogenase gamma subunit
accgccgtgggaacgatggcagatga	U40281	Human cysteine protease CMH-1 mRNA, complete cds.
cgccgggacgctgctatggacgacat	U40282	Homo sapiens integrin-linked kinase (ILK) mRNA, complete cds.
gggtcgctgccaagcatggcgcccac	U40317	Human protein tyrosine phosphatase PTPsigma (PTPsigma) mRNA,
gccgccagtgtcgacatgctgctgga	U40343	Human CDK inhibitor p19INK4d mRNA, complete cds.
gcaccagtggccagaatgtccacgca	U40347	Human serotonin N-acetyltransferase mRNA, complete cds.
aagcaaaagacgaaaatggctaaatt	U40369	Human spermidine/spermine N1-acetyltransferase (SSAT) gene,
ttcgctccggacaccatggacaagtt	U40373	Human cell surface glycoprotein CD44 mRNA, complete cds.
gcaccagtggccagaatgtccacgca	U40391	Human serotonin N-acetyltransferase gene, complete cds.
gacactaattctggaatgtcaattcc	U40396	Human steroid receptor coactivator (SRC-1) mRNA, complete cds.
ggatctacacagaccatggccttgca	U40434	Human mesothelin or CAK1 antigen precursor mRNA, complete cds.
cataacctgaggaccatggatgctga	U40462	Human Ikaros/LyF-1 homolog (hIk-1) mRNA, complete cds.
ggaactcatatcaacatggcaaacct	U40490	Human nicotinamide nucleotide transhydrogenase mRNA, nuclear gene
ggctcggaggcgaagatggcgtccgg	U40571	Human alpha1-syntrophin (SNT A1) mRNA, complete cds.
ggctgcctgactggaatgagggtagc	U40572	Human beta2-syntrophin (SNT B2) mRNA, complete cds.
gccggctataggcgcatggaaggttc	U40579	Human deoxyhypusine synthase mRNA, complete cds.
ctgaggtattaagaaatggagagaaa	U40622	Human XRCC4 mRNA, complete cds.
cagtccactgctctgatgccgaaggg	U40623	Human subtilisin-like protease PC8 precursor (PC8) mRNA, complete
agtggcccctgtgagatggctgagca	U40671	Human DNA ligase III mRNA, complete cds.
atcgagccatttaacatggcggagga	U40705	Homo sapiens telomeric repeat binding factor (TRF1) mRNA, complete
ttaagtattggagccatgggaataaa	U40763	Human Clk-associated RS cyclophilin CARS-Cyp mRNA, complete cds.
cgcaggactgagaccatggaggcggt	U40846	Human alpha-N-acetylglucosaminidase (NAG) mRNA, complete cds.
ccgggggtcgcgggtatggccgaggc	U40847	Human Treacher Collins syndrome (TCOF1) mRNA, complete cds.
cccctggccgagatcctgagcgtgaa	U40989	Human tat interactive protein mRNA, complete cds.
ttcaaggcattcgaaatggggaaaga	U40992	Homo sapiens heat shock protein hsp40 homolog mRNA, complete cds.
cggccccgcaaggccatgaaggtgaa	U40998	Human retinal protein (HRG4) mRNA, complete cds.
ggagacgaaggcgcaatggcgaggaa	U41060	Homo sapiens estrogen regulated LIV-1 protein (LIV-1) mRNA,
gtcctcccgacggccatgaacactac	U41070	Human P2 purinergic receptor mRNA, complete cds.
ctagtcgcggacgcaatggcttcaag	U41284	Homo sapiens cytochrome c oxidase (COX5B) gene, partial cds.
ttcaaggcattcgaaatggggaaaga	U41290	Human DNAJ homolog (DNAJW) gene, complete cds.
ggtggaacagcaatcatgactgttgg	U41303	Human small nuclear ribonuleoprotein particle N (SNRPN) mRNA,
gtgggataagcagtaatggcggaggc	U41315	Human ring zinc-finger protein (ZNF127-Xp) gene and 5' flanking
caacattaggagtaggagcggcagtt	U41316	Human ZNF127-Xq pseudogene.
cacctccaggccactatggcgcctgg	U41371	Human spliceosome associated protein (SAP 145) mRNA, complete cds.
gtccgtgcctccaagatggtgagtct	U41448	Homo sapiens ribosomal protein S26 (RPS26) gene, complete cds.
tcagcaggcaaaaagatgccagtaat	U41492	Homo sapiens clone HTG-5 photoreceptor transducin gamma subunit
ttgacttaaagtgccatgagaaaatt	U41514	Human UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase
gcgcggacagtcgagatgtcagagaa	U41515	Human deleted in split hand/split foot 1 (DSS1) mRNA, complete cds.
aagccccctgccagcatggccagcga	U41517	Human channel-like integral membrane protein (AQP-1) mRNA, clone
gaaggggaacgaaagatggcggcgga	U41635	Human OS-9 precurosor mRNA, complete cds.
gttcatcttctcaccatgaggctccc	U41643	Human germline Ig kappa V region IGKV (allele VkA2b) gene, complete
gttcatcttctcaccatgaggctccc	U41644	Human germline Ig kappa V region IGKV (allele VkA2c) gene, complete
gttcatcttctcaccatgaggctccc	U41645	Human germline Ig kappa V region IGKV (allele VkA18b) gene,
gtgccccggcgggtgatgccaaatac	U41654	Human adenovirus protein E3-14.7k interacting protein 1 (FIP-1)
tgaatcgtgggtgggatggccgcggg	U41668	Human deoxyguanosine kinase mRNA, complete cds.
gggtcgctgccaagcatggcgcccac	U41725	Human protein tyrosine phosphatase PTPsigma-(brain) (PTPsigma)
tacgtacgctgcgccatgttcaagaa	U41740	Human trans-Golgi p230 mRNA, complete cds.
gcgtgccgccacccgatggaagattc	U41742	Human nucleophosmin-retinoic acid receptor alpha fusion protein
gcgtgccgccacccgatggaagattc	U41743	Human nucleophosmin-retinoic acid receptor alpha fusion protein
cgcggcggcgcctcaatgcctaaagg	U41745	Human PDGF associated protein mRNA, complete cds.
ggtcccgcaccagccatggcgcagat	U41763	Human muscle specific clathrin heavy chain (CLTD) mRNA, complete
gcggaatcggccgagatggggtctgg	U41766	Human metalloprotease/disintegrin/cysteine-rich protein precursor
cagagggtgacccggatgatggcggc	U41804	Human putative T1/ST2 receptor binding protein precursor mRNA,
ccctcgccgctcgctatggcgtcgct	U41806	Human EBI3-associated protein p60 mRNA, complete cds.
agactcattttgaagatgtttaacaa	U41815	Human nucleoporin 98 (NUP98) mRNA, complete cds.
gggctgtaactggagatggaattccg	U41843	Human Dr1-associated corepressor (DRAP1) mRNA, complete cds.
gtcgaggaggagagaatgaccgaggt	U42029	Human P2Y1 purinoceptor mRNA, short form, complete cds.
gtcgaggaggagagaatgaccgaggt	U42030	Human P2Y1 purinoceptor mRNA, long form, complete cds.
ccccacctcgccgccatgcgcctccg	U42068	Human liver endoplasmic reticulum P58 mRNA, complete cds.
ggcccgagccgtcggatgcccgcgcg	U42217	Human N-methyl purine DNA-glycosylase (MPG) gene, partial cds.
cactgccctgccgcgatgggggcccg	U42349	Human N33 mRNA, complete cds.
ctcaatgcaaacactatgcggagagc	U42361	Human protein tyrosine phosphatase Cr1PTPase precursor (Ch-1PTPase
gccatcctctccagaatgaagatctt	U42376	Human retinoic acid induced RIG-E precursor (E) mRNA, complete cds.
cttttcacatccactatgaacacctc	U42387	Human pancreatic polypeptide receptor mRNA, complete cds.
ggacctgtactgaaaatgggtccaat	U42389	human neuropeptide y/peptide YY receptor type 2 mRNA, complete cds.
cgaaaaaacgatgaaatgaaagctat	U42390	Homo sapiens Trio mRNA, complete cds.
cggggctcctgcagcatggctgtcag	U42408	Human ladinin (LAD) mRNA, complete cds.
cgggcgcctcttgcaatggagacggt	U42412	Human 5'-AMP-activated protein kinase, gamma-1 subunit mRNA,
ctgcccccagtgaatatggtgaagaa	U42600	Human calcium-activated potassium channel beta subunit mRNA,
ggctgcagttctctcatggctcgcac	U42604	Human UDP-glucuronosyltransferase (UGT1H), exon 1.
cctggaaaggacaccatgagcactga	U42625	Human tumor necrosis factor alpha (TNFA) gene, allele TNFAp4,
ggacctgtactgaaaatgggtccaat	U42766	Human neuropeptide y2 receptor mRNA, complete cds.
cagccaggggccagcatgagccggag	U43030	Homo sapiens cardiotrophin-1 (CTF1) mRNA, complete cds.
aggcactttggaagaatgactctgga	U43083	Human G alpha-q (Gaq) mRNA, complete cds.
cccggtccttccaccatgcacttgct	U43142	Human vascular endothelial growth factor related protein VRP mRNA,
gcgcagcggccggagatgcagcgggg	U43143	Human receptor tyrosine kinase Flt4 (short form) mRNA, complete
attggagaagaggctatgtttaatcc	U43148	Human patched homolog (PTC) mRNA, complete cds.
cttctctgaagtaagatgatttgtca	U43168	Human leptin receptor (Ob-r) mRNA, complete cds.
accaggtgaacggccatggcgggctg	U43185	Human signal transducer and activator of transcription Stat5A mRNA,
cctcagggaataacaatgacatcagc	U43188	Human Ets transcription factor (NERF-2) mRNA, complete cds.
agccccgggataaacatggcgacgtc	U43189	Human Ets transcription factors NERF-1a and NERF-1b (NERF-1a,b)
gcgcagcgaagcccgatgtggtccgg	U43203	Human thyroid transcription factor 1 (TTF-1) mRNA, complete cds.
aaagtgaacgccgccatgaaaagaca	U43279	Human nucleoporin nup 36 mRNA, complete cds.
tgccgggcaggcgccatggcggaagc	U43286	Homo sapiens selenophosphate synthetase 2 (SPS2) mRNA, complete
aggactgggcacagcatgagatccaa	U43292	Human MDS1B (MDS1) mRNA, complete cds.
gggagggagggggcgatggctcggcc	U43318	Human putative transmembrane receptor (frizzled 5) mRNA, complete
ctttgggctataaagatgaagagtct	U43328	Human link protein mRNA, complete cds.
cccgccctgcgcgccatgaacgcccc	U43341	Human transcription factor NFAT1 isoform B (NFAT1) mRNA, complete
cccgccctgcgcgccatgaacgcccc	U43342	Human transcription factor NFAT1 isoform C (NFAT1) mRNA, complete
gccccggcgggcaccatgagccctct	U43370	Human VEGF related factor (VRF) gene, partial cds.
ggagccgctgccgctatggatgatcg	U43399	Human 14-3-3 protein epsilon isoform mRNA, complete cds.
actccttctccagacatgcttcccga	U43408	Human tyrosine kinase (Tnk1) mRNA, complete cds.
ttggagccggaagccatggcacacta	U43416	Human replication control protein 1 (PARC1) mRNA, complete cds.
ggagccgctgccgctatggatgatcg	U43430	Human epsilon isoform 14-3-3 protein mRNA, complete cds.
ttttcccgcgccgccatggagatggc	U43431	Human DNA topoisomerase III mRNA, complete cds.
gtttttatgcaacctatggtcatgca	U43519	Human dystrophin-related protein 2 (DRP2) mRNA, complete cds.
ctgctgcctgagaggatgtctggggt	U43522	Human cell adhesion kinase beta (CAKbeta) mRNA, complete cds.
gctcttctcaccaagatgaactcact	U43527	Human malignant melanoma metastasis-suppressor (KiSS-1) gene, mRNA,
acttgggctccagctatgtggctgcc	U43559	Human 11-cis retinol dehydrogenase mRNA, complete cds.
cgcaggactgagaccatggaggcggt	U43572	Human alpha-N-acetylglucosaminidase (NAGLU) gene, complete cds.
atcctgggaaggaaaatgcattgggg	U43653	Human obese protein (ob) mRNA, complete cds.
agcagaatccaaaccatgaattgtag	U43672	Human putative transmembrane receptor IL-1Rrp mRNA, complete cds.
gacccttttcacaagatggcgccgaa	U43701	Human ribosomal protein L23a mRNA, complete cds.
atatcgtaggtaaaaatgcctattgg	U43746	Human breast cancer susceptibility (BRCA2) mRNA, complete cds.
cagacccggagcagcatgtggactct	U43747	Human frataxin (FRDA) mRNA, complete cds.
cgccccgcgggggccatggatggtga	U43784	Human mitogen activated protein kinase activated protein kinase-3
ctccccagagacaccatgattcctgg	U43842	Homo sapiens bone morphogenetic protein-4 (hBMP-4) gene, complete
cgagacgcgcgcaccatgagcggtgg	U43885	Human Grb2-associated binder-1 mRNA, complete cds.
gggctggaggtcgccatggggcgagg	U43895	Homo sapiens hepatocyte growth factor-regulated tyrosine kinase
cggcacgcagcggagatgcctctttt	U43899	Human signal transducing adaptor molecule STAM mRNA, complete cds.
agggaaactttcacaatgtccggagc	U43901	Homo sapiens 37 kD laminin receptor precursor/p40 ribosome
ttcccatcggcgaagatggccctgga	U43923	Human transcription factor SUPT4H mRNA, complete cds.
gttttgagtctagaaatgaatttaag	U43965	Human ankyrin G119 (ANK3) mRNA, complete cds.
cgagtccggggcacgatgtccgacgc	U44059	Human thyrotroph embryonic factor (TEF) mRNA, complete cds.
aataaccgtccagtgatgcctgacca	U44060	Human homeodomain protein (Prox 1) mRNA, complete cds.
gaaaaacttgaacaaatggacaatat	U44378	Human homozygous deletion target in pancreatic carcinoma (DPC4)
taaagacaaaaaaaaatggaggaatc	U44388	Homo sapiens 60-kD SS-A/Ro ribonucleoprotein gene, exon 2 region
gggaaaaagaaagaaatgggaaacag	U44403	Human Src-like adapter protein mRNA, complete cds.
tcgaagtcagccaccatggaggcgca	U44427	Human D53 (hD53) mRNA, complete cds.
ctctttctgagcggcatgaagccacc	U44755	Human PSE-binding factor PTF delta subunit mRNA, complete cds.
ggtagcgcttgcagcatggctgacca	U44758	Human calmodulin 2 (CALM2 P4) pseudogene.
acagcgttgcagaacatgaacgattg	U44798	Human U1-snRNP binding protein homolog mRNA, complete cds.
agctttgcagagaacatgaacgattg	U44799	Human U1-snRNP binding protein homolog mRNA, complete cds.
gggcagttgatcatcatggagacccg	U44839	Human putative ubiquitin C-terminal hydrolase (UHX1) mRNA, complete
gaaaggtggctgaaaatggtgcagaa	U44888	Human myocyte-specific enhancer factor 2A MEF2A pseudogene.
ctctttctgagcggcatgaagccacc	U44898	Human SNAP45 subunit mRNA, complete cds.
tgatgaattggaaccatggtgcaaaa	U44953	Homo sapiens DENN mRNA, complete cds.
gcacacccggggaccatgggctccat	U45285	Human specific 116-kDa vacuolar proton pump subunit (OC-116KDa)
cgagggactttgaacatgtcggggat	U45328	Human ubiquitin-conjugating enzyme (UBE2I) mRNA, complete cds.
ctctcgctgtgagacatgtctgagac	U45432	Human ETV6 gene, promoter region and partial cds.
cccagccggcccaccatggcacggcg	U45448	Human P2x1 receptor mRNA, complete cds.
cccattcatttcattatgaacatagt	U45878	Human inhibitor of apoptosis protein 1 mRNA, complete cds.
tactgtcacctactcatgcacaaaac	U45879	Human inhibitor of apoptosis protein 2 mRNA, complete cds.
tattttcaagagaagatgacttttaa	U45880	Human X-linked inhibitor of apotosis protein XIAP mRNA, complete
ccccgcgccaccaagatggtcatcca	U45945	Human Na,K-ATPase beta 2 subunit (ATP1B2) mRNA, complete cds.
ggaggagctgcagagatgtccggcca	U45976	Human clathrin assembly protein lymphoid myeloid leukemia (CALM)
agccctattcctaacatggctgatga	U45982	Human G protein-coupled receptor GPR-9-6 gene, complete cds.
ggtcccgctgccttgatggattatac	U45983	Homo sapiens CCR8 chemokine receptor (CMKBR8) gene, complete cds.
ttttttctgcccacaatgagcggggt	U45984	Homo sapiens CCR6 chemokine receptor (CMKBR6) gene, complete cds.
ccgtccagcagcaccatgtgggtgac	U46010	Human HGF agonist/antagonist mRNA, complete cds.
ttccagtttccagacatggctgatgg	U46023	Human Xq28 mRNA, complete cds.
ccgagagtttccaggatggcttctgc	U46024	Homo sapiens myotubularin (MTM1) mRNA, complete cds.
ctccgcgccgtcgccatgtcgcggtt	U46025	Human translation initiation factor eIF-3 p110 subunit gene,
cttgcgctgcccgccatgccaccgcc	U46066	Human ferritin pseudogene, complete cds.
acggtcccggacgcgatgaccctgaa	U46165	Human Rad GTPase gene, complete cds.
ggaccggcctatgtcatggaactgcc	U46191	Human renal cell carcinoma antigen RAGE-1 mRNA, complete putative
ggaccggcctatgtcatggaactgcc	U46192	Human renal cell carcinoma antigen RAGE-2 mRNA, complete putative
ggaccggcctatgtcatggaactgcc	U46193	Human renal cell carcinoma antigen RAGE-3 mRNA, complete putative
aaacagtcgagagctatgaattttga	U46194	Human renal cell carcinoma antigen RAGE-4 mRNA, complete putative
ggacgtcgtcgcgccatggcggagac	U46461	Human dishevelled homolog (DVL) mRNA, complete cds.
ccctcactgggcagcatgggggagaa	U46570	Human tetratricopeptide repeat protein (tpr1) mRNA, complete cds.
gagtgcgatgtggtaatggcggcgac	U46571	Human tetratricopeptide repeat protein (tpr2) mRNA, complete cds.
ccttcagcctccaacatgaaggtctc	U46572	Human eotaxin precursor gene, complete cds.
ccttcagcctccaacatgaaggtctc	U46573	Human eotaxin precursor mRNA, complete cds.
ctgcaggaccaggccatggagctcga	U46689	Human microsomal aldehyde dehydrogenase (ALD10) mRNA, complete cds.
cggcgtgtcaaaaaaatgtcagatga	U46691	Human putative chromatin structure regulator (SUPT6H) mRNA,
tccgtcgccgccaagatgatgtgcgg	U46692	Human cystatin B gene, complete cds.
tcattgaattttagaatgattgaaga	U46744	Human dystrobrevin-alpha mRNA, complete cds.
aactacaaaaccagaatgattgaaga	U46745	Human dystrobrevin-beta mRNA, complete cds.
gaacctttgcaccccatgttcccaga	U46746	Human dystrobrevin-epsilon mRNA, complete cds.
agctcgccgctcgctatggcgtcgct	U46751	Human phosphotyrosine independent ligand p62 for the Lck SH2 domain
ctcttaaccttcaacatgaaagtctc	U46767	Homo sapiens monocyte chemoattractant protein-4 precursor (MCP-4)
gaaacttctcagagaatgctccaaaa	U46768	Human stanniocalcin mRNA, complete cds.
cggcactaagcaaatatggacctcgc	U46838	Human p105MCM mRNA, complete cds.
gctcgcaggccgcggatgaagaagaa	U46917	Human Bcl-2 associating athanogene-1 protein (hBAG-1) mRNA,
cagagggtgggcaagatggcggcgcc	U46920	Human metaxin (MTX) gene, complete cds.
ttcaactgtgaggacatgtcgttcag	U46922	Human FHIT mRNA, complete cds.
ctatcgtcgtcagtcatggctagcat	Z82254	Human DNA sequence from clone LL0XNC01-46H11 on chromosome X
gcctccgccggcgcgatgggcgaacc	U47025	Human fetal brain glycogen phosphorylase B mRNA, complete cds.
tgcttctctaggtccatggagggaag	U47050	Human putative calcium influx channel (htrp3) mRNA, complete cds.
caaaagaagagaaaaatgaagacggg	U47054	Human putative mono-ADP-ribosyltransferase (htMART) mRNA, complete
gcgggactcggcggcatggcgggctc	U47077	Homo sapiens DNA-dependent protein kinase catalytic subunit
atattttgcttcgaaatggaaccagc	U47105	Homo sapiens H105e3 (H105e3) mRNA, complete cds.
gcagtctctgtcaagatgatagaggt	U47413	Human cyclin G1 mRNA, complete cds.
cgcgtctccggcacgatgaaggattt	U47414	Human cyclin G2 mRNA, complete cds.
gcccagctgggcctcatgcctctgac	U47654	Homo sapiens pyruvate kinase PK-R isoenzyme gene, partial cds; and
ttggctgctagagcgatgccgggccg	U47674	Homo sapiens putative heart protein PHP mRNA, complete cds.
gcgagattgtaaaccatggctgtgtg	U47686	Human signal transducer and activator of transcription Stat5B mRNA,
cgcgagcaggtgaaaatggctgagaa	U47741	Human CREB-binding protein (CBP) mRNA, complete cds.
acagaatccttcaccatggtaaaact	U47742	Human monocytic leukaemia zinc finger protein (MOZ) mRNA, complete
agacccgaggctagcatgggctgcag	U47743	Human T cell receptor beta chain (TCRB) mRNA, VDJ region, partial
agacccgaggctagcatgggctgcag	U47744	Human T cell receptor beta chain (TCRB) mRNA, Vbeta7 region,
tgggtccatcatgcaatgctgagcac	U47925	Human protein A alternatively spliced form 1 (A-1) mRNA, complete
tttgtagcaaaccccatgcacctgca	U47926	Human unknown protein B mRNA, complete cds.
gctgctgccggtgtcatggcggagct	U47927	Human isopeptidase T (ISOT) mRNA, complete cds.
ggggctgaggataggatggctcgggg	U47928	Human protein A alternatively spliced form 2 (A-2) mRNA, complete
ctcgacctgtcagccatgggggagat	U47930	Human G-protein beta-3 subunit mRNA, partial cds.
gccctgaggcgagacatgggcacctg	U48257	Human/HTLV-1 interleukin-9 receptor chimeric mRNA (alternatively
gccctgaggcgagacatgggcacctg	U48258	Human/HTLV-1 interleukin-9 receptor chimeric mRNA (authentically
ggccccctttgcactatgagcaacca	U48259	Human T cell receptor beta chain variable region (Vb17) gene,
ggccccctttgcactatgagcaacca	U48260	Human T cell receptor beta chain variable region (Vb17) gene,
tcctgctcctgcaccatgaaagtcct	U48263	Human pre-pro-orphanin FQ (OFQ) mRNA, complete cds.
ttttaactaaataacatggctcgaat	U48296	Homo sapiens protein tyrosine phosphatase PTPCAAX1 (hPTPCAAX1)
tttttatttgccataatgaaccgtcc	U48297	Homo sapiens protein tyrosine phosphatase PTPCAAX2 (hPTPCAAX2)
gatctccggccgtccatgcacagagc	U48361	Human NGFI-A binding protein 2 (NAB2) mRNA, complete cds.
ccttcaggcccaaagatggggaacat	U48405	Human G protein coupled receptor OGR1 gene, complete cds.
ccaaggcaccaggacatggatgctga	U48408	Human kidney water channel (hKID) mRNA, complete cds.
cgccgcctggccgctatggatctatt	U48436	Homo sapiens fragile X mental retardation protein FMR2p (FMR2)
cgcaagggccgggacatggggcccgc	U48437	Homo sapiens amyloid precursor-like protein 1 (APLP1) mRNA,
gagggatcaggagctatgggaccaga	U48705	Human receptor tyrosine kinase DDR gene, complete cds.
cttcggggagcagcgatgcgaccctc	U48722	Human epidermal growth factor receptor precursor (EGFR) mRNA,
agcgagaggcgcggaatggtggacta	U48734	Human non-muscle alpha-actinin mRNA, complete cds.
agtctttctgaaggaatgaaagttga	U48736	Human serine/threonine-protein kinase PRP4h (PRP4h) mRNA, complete
gcagacatggggaccatgaagaccca	U48795	Homo sapiens antimicrobial protein CAP18 precursor, gene, complete
cggttcccggcgaccatggtgacgat	U48807	Human MAP kinase phosphatase (MKP-2) mRNA, complete cds.
gcctccctcagcaccatgtaccgagc	U48857	Human fumarase mRNA, nuclear gene encoding mitochondrial protein,
ccggccccgccggccatgaggcgcgc	U48861	Human beta 4 nicotinic acetylcholine receptor subunit mRNA,
gggggcgggccggccatgtcccacgg	U48865	Human C/EBP epsilon (CEBPE) gene, complete cds.
gcgcagccccgggccatgtccgacgc	U48869	Human cdk-inhibitor p57/KIP2 (CDKN1C) gene, complete cds.
agtcccatcctcgccatggcacccgg	U48936	Human amiloride-sensitive epithelial sodium channel gamma subunit
gagaagacggtgaccatgggggatgt	U48959	Homo sapiens myosin light chain kinase (MLCK) mRNA, complete cds.
cagcccggtttggggatgtggtcctt	U49065	Human interleukin-1 receptor-related protein mRNA, complete cds.
gcacctcgagggaagatggcggacga	U49070	Human peptidyl-prolyl isomerase and essential mitotic regulator
ggtgtgccctgagccatggaggcgcc	U49082	Human transporter protein (g17) mRNA, complete cds.
gcttatggtgcagacatggccaagtc	U49083	Human cell surface heparin binding protein HIP mRNA, complete cds.
gcggggggcagtgccatgcacaagca	U49089	Human neuroendocrine-dlg (NE-dlg) mRNA, complete cds.
cattgacaatcagccatgtcatccag	U49184	Human occludin mRNA, complete cds.
ggcaaactgaagaaaatgcacaattt	U49187	Human placenta (Diff48) mRNA, complete cds.
atcactggcgtcaccatgggggctgt	U49188	Human placenta (Diff33) mRNA, complete cds.
aaggctatcctcaccatgacccagct	U49240	Human symplekin mRNA, complete cds.
cgcagtccaggaatcatgctggagaa	U49248	Human canalicular multispecific organic anion transporter (cMOAT),
tcaggttctagagctatgcagctgga	U49250 S78865	Human putative cerebral cortex transcriptional regulator T-Brain-1
tccgaggtcagagtcatggacgagac	U49262	Human dishevelled (DVL) mRNA, complete cds.
ggtcttttcatgctcatggcggtatt	U49283	Human NAD+-specific isocitrate dehydrogenase beta subunit
gaaactcttgcacaaatgtacaatac	U49349	Human alternatively spliced p85/AS53 mRNA, partial cds.
tgccgaattcgcggaatgaagctacc	U49352	Human liver 2,4-dienoyl-CoA reductase mRNA, complete cds.
tcgtccttggagaagatggaagcgga	U49379	Human diacylglycerol kinase epsilon DGK mRNA, complete cds.
cagatctgctgagctatgagccaaac	U49392	Human allograft inflammatory factor-1 (AIF-1) mRNA, complete cds.
ggctgagagcgcgccatggggcaggc	U49395	Human ionotropic ATP receptor P2X5a mRNA, complete cds.
ggctgagagcgcgccatggggcaggc	U49396	Human ionotropic ATP receptor P2X5b mRNA, complete cds.
gccgccagtgtcgacatgctgctgga	U49399	Human inhibitor of cyclin-dependent kinase 4 d INK4d mRNA, complete
cactaataagccaaaatgtctgtcaa	U49436	Human translation initiation factor 5 (eIF5) mRNA, complete cds.
aagactgaagcaatcatggtgaacct	U49516	Human serotonin 5-HT2c receptor mRNA, complete cds.
acagggagaagtgaaatgacaacctc	U49727	Human C-C chemokine receptor 3 (CKR-3) gene, complete cds.
gccgccagaggagaaatgtctgaagt	U49730	Homo sapiens apoptosis inducer Nbk mRNA, complete cds.
aaaggaaaggggaaaatgtctcagtc	U49732	Human MAP kinase kinase MEK6 (MEK6) mRNA, complete cds.
cgagtgtgcttagcgatggcctggaa	U49740	Human L-isoaspartyl/D-aspartyl O-methyltransferase (PCMT1) gene,
acaagggccacagccatgaatggcac	U49742 K02281	Human rhodopsin gene, complete cds.
gttcctctgcccgccatgccgttcct	U49785	Human D-dopachrome tautomerase mRNA, complete cds.
atgggagcaaccaccatggaccagaa	U49835	Human YKL-39 precursor mRNA, complete cds.
cagatagtcttcaagatgccaaactg	U49837	Human LIM protein MLP mRNA, complete cds.
cctcgcagcctcagcatgggggaaca	U49844	Human FRAP-related protein (FRP1) mRNA, complete cds.
gggcagctctctggcatgttcctgac	U49857	Human transcriptional activator mRNA, complete cds.
tcccggggagccagcatgtccactgc	U49897	Homo sapiens phenylalanine hydroxylase (PAH) mRNA, complete cds.
cagggttcctccaagatggcggcgca	U49928	Homo sapiens TAK1 binding protein (TAB1) mRNA, complete cds.
caattgattccaacaatgtctcaccc	U49957	Human LIM protein (LPP) mRNA, partial cds.
gaggagttgcttcttatggatgagca	U49973	Human Tigger1 transposable element, complete consensus sequence.
ccctatcagagcaacatgaattctgc	U49974	Human mariner2 transposable element, complete consensus sequence.
gcccactaatccttgatgttcacctt	U50040	Human signaling inositol polyphosphate 5 phosphatase SIP-110 mRNA,
gaaggataaatcaacatggcaactat	U50078	Human guanine nucleotide exchange factor p532 mRNA, complete cds.
ggggaggcgagcaagatggcgcagac	U50079	Human histone deacetylase HD1 mRNA, complete cds.
cacaccgacggtaccatgaaggacga	U50136	Human leukotriene C4 synthase (LTC4S) gene, complete cds.
gagaaaggtgatgccatgattatgga	U50137	Human p38-2G4 mRNA, partial cds.
cactccgtcagtgagatggcctccaa	U50158	Human cAMP-specific phosphodiesterase HPDE4D2 variant (PDE4D) mRNA,
agaagatctgcgaacatgatgcacgt	U50159	Human cAMP-specific phosphodiesterase HPDE4D3 variant (PDE4D) mRNA,
caggaggcgaagccaatgacgtcagt	U50196	Human adenosine kinase mRNA, complete cds.
taagattacagcaagatggaaatacc	U50315	Human enhancer of zeste homolog 1 (EZH1) mRNA, complete cds.
taagtgacagaaggaatggagaccct	U50404	Human T cell receptor V-alpha 23 precursor (TCRA) mRNA, partial
ctccctgcgaacgagatggccgggac	U50410	Human heparan sulphate proteoglycan (OCI5) mRNA, complete cds.
gacaaaacaaaagtgatggtcagtat	U50523	Human BRCA2 region, mRNA sequence CG037.
taggggtagagtaagatgtcttatgg	U50532	Human BRCA2 region, mRNA sequence CG005.
cggtactcttcagggatgagtcatgt	U50553	Homo sapiens helicase like protein 2 (DDX14) mRNA, complete cds.
cggtggtgagcggggatggcggttgt	U50708	Human branched chain alpha-ketoacid dehydrogenase E1 beta subunit
cgtctcgccgccgccatggcggaccc	U50733	Human dynamitin mRNA, complete cds.
ggttgtcgatggacggtggcggcagc	U50743	Human Na,K-ATPase gamma subunit mRNA, complete cds.
gtaggaaatcgaaacatgaccaaatc	U50822	Human neurogenic helix-loop-helix protein NEUROD (neurod) gene,
tcttgataaaaagagatgtgggggga	U50839	Homo sapiens g16 protein (g16) mRNA, complete cds.
tccagaggcagggctatgctcacatt	U50871	Human familial Alzheimer's disease (STM2) gene, complete cds.
acgccagtgaccgcgatggtgaactc	U50928	Human autosomal dominant polycystic kidney disease type II (PKD2)
ctggacaccacaaagatgccacccgt	U50929	Human betaine:homocysteine methyltransferase mRNA, complete cds.
gcggcaggcgcggccatggcgcagct	U50939	Human amyloid precursor protein-binding protein 1 mRNA, complete
ttgatctcacagttgatggactgctg	U50950	Human infant brain unknown product mRNA, complete cds.
tcgccccttcgtattatgtctgcact	U50964	Human G protein-activated inwardly rectifying potassium channel
aggagcatcagatccatgctgctgct	AL021683	Homo sapiens cDNA homologous to Yeast SCO1 & SCO2 genes and
ccgtctcgggccaggatgactggagt	U51003	Homo sapiens DLX-2 (DLX-2) gene, complete cds.
gggaggagaggcgagatggcagatga	U51004	Homo sapiens protein kinase C inhibitor (PKCI-1) mRNA, complete
gaggaaggtggcaagatggtgttgga	U51007	Human 26S protease subunit S5a mRNA, complete cds.
gaccccgcggccaccatgtatgtggg	U51095	Human homeobox protein Cdx1 mRNA, complete cds.
cggaccctcgccaccatgtacgtgag	U51096	Human homeobox protein Cdx2 mRNA, complete cds.
ctgctggtggtgacaatgtcaaataa	U51120	Human protein kinase PAK1 mRNA, complete cds.
acagacccctctgccatgaaccagtc	U51127	Human interferon regulatory factor 5 (Humirf5) mRNA, complete cds.
acgaggcgggacgtcatggaagtgaa	U51134	Homo sapiens calcitonin gene-related peptide receptor component
cagcggcctcggggaatggaagcgga	U51166	Human G/T mismatch-specific thymine DNA glycosylase mRNA, complete
aggccggccgcgaagatgccagtggc	U51205	Homo sapiens COP9 signalosome subunit 1 CSN1 (CSN1) mRNA, complete
ggcggtgctggcaagatggctgcact	U51224	Human U2AFBPL gene, complete cds.
ggggacggcagcaccatggacccccg	U51240	Human lysosomal-associated multitransmembrane protein (LAPTm5)
acagggagaagtgaaatgacaacctc	U51241	Human eosinophil eotaxin receptor (CMKBR3) gene, complete cds.
gtggtttctacaaagatgaaactact	U51243	Human alpha-albumin gene, complete cds.
gcgggcgctctggtcatggaggactg	U51269	Human armadillo repeat protein mRNA, complete cds.
ccactgtggaagctcatggactccat	U51333	Human hexokinase III (HK3) mRNA, complete cds.
ccgcggccgttagtcatgtcggattc	U51334	Human putative RNA binding protein (RBP56) mRNA, complete cds.
cgcccgaggaggaagatgcagacctt	U51336	Human inositol 1,3,4-trisphosphate 5/6-kinase mRNA, complete cds.
ggggaaagggcaaggatggtggaggc	U51338	Human retina fatty acid binding protein mRNA, complete cds.
aagaagcggtagaagatggcgctcac	U51432	Homo sapiens nuclear protein Skip mRNA, complete cds.
cggggctagggccggatggagccgcg	U51477	Human diacylglycerol kinase zeta mRNA, complete cds.
gtccgcgcgcacaccatgacgaagaa	U51478	Human sodium/potassium-transporting ATPase beta-3 subunit mRNA,
agccacacagcaaacatgtttgcaaa	U51587	Homo sapiens Golgi complex autoantigen golgin-97 mRNA, complete
tgcatagaaaatttaatggatgaaga	U51625	Human MOP4 mRNA, partial cds.
agggccacagcgacaatgacagctga	U51626	Human MOP2 mRNA, complete cds.
gggatccccgcaaggatgagtgctgc	U51678	Homo sapiens small acidic protein mRNA, complete cds.
acagcctgaactcagatgtcagcagc	U51869	Human proto-oncogene Bcd orf1 and orf2 mRNA, complete cds.
tctttaggtgcaataatgaagagttt	U51899	Human kappa-casein gene, complete cds.
ccggagacgcgcaggatgccacacga	U51903	Human RasGAP-related protein (IQGAP2) mRNA, complete cds.
cttaaagctgtcaagatggttctagc	U51920	Human signal recognition particle (SRP54) mRNA, complete cds.
aattctggcggcgagatggacattct	U51990	Human hPrp18 mRNA, complete cds.
tgtttattttagactatggaaatgat	U52077	Human mariner1 transposase gene, complete consensus sequence.
ccctgccctgtgaaaatgttggtgct	U52100	Human XMP mRNA, complete cds.
gcttccactgcagccatgtcactcct	U52101	Human YMP mRNA, complete cds.
gtggggagcgggccgatgtccagcct	U52144	Human isocitrate dehydrogenase mRNA, complete cds.
cctgacgcggccgccatggcgcagga	U52152	Human inwardly rectifying potassium channel Kir3.3 mRNA, complete
gaagaaactgcaacaatggccaagct	U52153	Human inwardly rectifying potassium channel Kir3.2 mRNA, complete
aacaacatcccagctatggctggcga	U52154	Human G protein-coupled inwardly rectifying potassium channel
cacctcggacccaagatgacgtcagt	U52155	Human ATP-dependent inwardly rectifying potassium channel Kir4.1
gcattaaggcccgacatggaaccggg	U52191	Human SMCY (H-Y) mRNA, complete cds.
atccccaggagcaacatggggcccac	U52219	Human melatonin-related receptor mRNA, complete cds.
gcattaaggcccgacatggaaccggg	U52365	Human SMCY mRNA, partial cds.
acttgaaagaagacgatgcatacagg	U52373	Human serine/threonine kinase MNB (mnb) mRNA, complete cds.
ctgagacctagagtcatggatgtatg	U52426	Homo sapiens GOK (STIM1) mRNA, complete cds.
acctggtctgggaagatgttctacca	U52427	Human RNA polymerase II seventh subunit (rpb-7) gene, complete cds.
ccctgcagagcagccatggaggaggt	U52428	Human fatty acid synthase gene, partial cds.
ctgggcagccatggaatggacaatgg	U52464	Human P2 purinoceptor (P2Y6) mRNA, complete cds.
acacagagggcagtcatgagtgaggt	U52513	Human RIG-G mRNA, complete cds.
gccccgagcagcggcatggagtccgt	U52518	Human Grb2-related adaptor protein (Grap) mRNA, complete cds.
gccgaggagtctaccatggctcaaga	U52521	Human arfaptin 1, putative target protein of ADP-ribosylation
ggcccggcccgagccatgacggacgg	U52522	Human arfaptin 2, putative target protein of ADP-ribosylation
cccaatgcctcctgaatgatgccagc	U52696	Human adrenal Creb-rp homolog (Creb-rp), complete cds, and
tgcccagcctcctgaatgatgccagc	U52699	Human tenascin-X (XB) mRNA, RACE clone M1, partial cds.
cttcaggcctcctgaatgatgccagc	U52700	Human tenascin-X (XB) mRNA, RACE clone N1, partial cds.
ccgaaggcctcctgaatgatgccagc	U52701	Human adrenal Creb-rp homolog (Creb-rp) and tenascin-X (XB) mRNA,
ggccccttgcccaccatgaagggaac	U52840	Homo sapiens semaphorin F homolog mRNA, complete cds.
ccctgacgcaggaacatggagctgat	U52852	Homo sapiens TS PST1 (STP1) gene, complete cds.
cttctctgaagtaagatgatttgtca	U52912	Human B219/OB receptor isoform HuB219.1 precursor mRNA, complete
cttctctgaagtaagatgatttgtca	U52913	Human B219/OB receptor isoform HuB219.2 precursor mRNA, complete
cttctctgaagtaagatgatttgtca	U52914	Human B219/OB receptor isoform HuB219.3 precursor mRNA, complete
cggagtctgagggagatggaagttga	U52962	Human centrosomal protein kendrin mRNA, complete cds.
ccactgttttttaaaatgggagatga	U52965	Human putative transcriptional regulator ENX-1 mRNA, complete cds.
tgagttagagccaacatgagtgagcg	U52969	Human PEP19 (PCP4) mRNA, complete cds.
gctgtcctcaccgcaatggcggctgt	U53003	Human GT335 mRNA, complete cds.
gagcgctggggcagcatgaagtgcct	U53174	Human cell cycle checkpoint control protein mRNA, complete cds.
agccaccaggaggccatgtcgggtga	U53204	Human plectin (PLEC1) mRNA, complete cds.
gagcgcctcgtcgacatgagtgatgt	U53209	Human transformer-2 alpha (htra-2 alpha) mRNA, complete cds.
ctgcacggggtcccgatggacctcaa	U53212	Human degenerin channel MDEG mRNA, partial cds.
gcccaggggtgcgctatgccgtcggg	U53220	Human retinoblastoma-related Rb2/p130 gene, 5' flanking region and
actgatcctgagaagatggcgtcggg	U53225	Human sorting nexin 1 (SNX1) mRNA, complete cds.
gataatggcctcagaatgactgcaag	U53328	Human cyclin G mRNA, complete cds.
cgtgcgacggccgtgatgaagttcgc	U53346	Human PWP2H protein mRNA, complete cds.
ccggtgcttcccatcatggtggccga	U53347	Human neutral amino acid transporter B mRNA, complete cds.
aattctgctccggacatgtcgggccc	U53442	Human p38Beta MAP kinase mRNA, complete cds.
aagtcttttgctttgatggtggtgga	U53445	Human ovarian cancer downregulated myosin heavy chain homolog
gcctgccttcttgccatgtctaacga	U53446	Human mitogen-responsive phosphoprotein DOC-2 mRNA, complete cds.
cagcgcgctccggtcatggagatccc	U53447	Homo sapiens PAPS synthase gene, complete cds.
ccgcactctgctgctatgagcttcct	U53454	Human chloride ion current inducer protein (CLCI) mRNA, complete
gtcgttggcgctgtcatggcgggtgt	U53468	Homo sapiens NADH:ubiquinone oxidoreductase subunit B13 (B13) mRNA,
aggcccacgcccaccatggtcccctg	U53470	Human signaling inositol polyphosphate phosphatase SHIP II mRNA,
gggccaatcgggactatgaaccggaa	U53476	Human proto-oncogene Wnt7a mRNA, complete cds.
caggaggcagagaagatgggcatcct	U53506	Human type II iodothyronine deiodinase mRNA, complete cds.
gtctatcccccgaccatggcgaagct	U53784	Human serum aryldialkylphosphatase precursor mRNA, complete cds.
cttgcctttacgaccatgttcaaggg	U53786	Homo sapiens envoplakin (EVPL) mRNA, complete cds.
ctgtaagaaagcaagatgcattttag	U53821	Homo sapiens adapt78 protein gene, partial cds.
cattgacaatcagccatgtcatccag	U53823	Human tight junction protein occludin mRNA, complete cds.
tctgctgacagcgtcatggggggcag	U53830	Homo sapiens interferon regulatory factor 7A mRNA, complete cds.
tctgctgacagcgtcatggggggcag	U53831	Homo sapiens interferon regulatory factor 7B mRNA, complete cds.
ctggacgtgaccatcatgtacaaggg	U53832	Homo sapiens interferon regulatory factor 7C mRNA, complete cds.
cagagagttgggggaatggatggaga	U53930	Human olfactory receptor 17-30 (OLFR 17-30) gene, complete cds.
tgcagattttggaagatggcaaagtt	U54558	Homo sapiens translation initiation factor eIF3 p66 subunit mRNA,
cgggtgggcgtcaagatgaaggcggc	U54617	Human pyruvate dehydrogenase kinase isoform 4 mRNA, complete cds.
ccgcccccgagagacatgacttccaa	U54644	Human tub homolog mRNA, complete cds.
ccctgacgcaggaacatggagctgat	U54701	Human phenol sulfotransferase (STP) gene, complete cds.
ttgccggctgtcggtatgtcgcgaca	U54777	Homo sapiens hMSH6 protein (MSH6) mRNA, complete cds.
ggagccgctgccgctatggatgatcg	U54778	Human 14-3-3 epsilon mRNA, complete cds.
caagagctgaacaagatgcattgtga	U54804	Human Has2 mRNA, complete cds.
actagtgctgtcattatgaatgtgac	U54826	Human mad-related protein MADR1 mRNA, complete cds.
ggtaacggggcagagatgtggttcga	U54993	Human mitochondrial complex I hMWFE subunit mRNA, nuclear gene
cccgggtggaacaagatggattatca	U54994	Human CC chemokine receptor 5 (CCR5) mRNA, complete cds.
gttcccgtcttggccatggcctcgtt	U54996	Human protein ZW10 homolog (HZW10) mRNA, complete cds.
gaaaatttgataagcatgagagaaga	U54999	Human LGN protein mRNA, complete cds.
aacccagggagcgcgatgggctgcag	U55058	Human uroguanylin gene, complete cds.
gaggcggcgagcgccatggccagtcc	U55206	Homo sapiens human gamma-glutamyl hydrolase (hGH) mRNA, complete
tcctgacttgggaccatggtgattct	U55208	Human myosin VIIa long transcript mRNA, complete cds.
tcctgacttgggaccatggtgattct	U55209	Human myosin VIIa transcript 2 mRNA, complete cds.
atgcagcttaaaataatgccgaaaaa	U55258	Human hBRAVO/Nr-CAM precursor (hBRAVO/Nr-CAM) gene, complete cds.
agaaaaaaagtgaatatggtttttgc	U55312	Human G protein-coupled receptor GPR-NGA gene, complete cds.
gagttttgattcatcatggataatct	U55936	Human SNAP-23 mRNA, complete cds.
tttggttgctgacaaatgtcttttta	U56079	Human Y5 receptor mRNA, complete cds.
cgtgcgacggccgtgatgaagttcgc	U56085	Human periodic tryptophan protein 2 (PWP2) mRNA, complete cds.
aaacagtttccagagatggattatcc	U56102	Human adhesion molecule DNAM-1 mRNA, complete cds.
gcgtggacgcccttcatggcggctga	U56386	Human SH3 binding protein 3BP2 (3BP2) mRNA, complete cds.
cgagagcagcggaagatgtcggacag	U56402	Human chromatin structural protein homolog (SUPT5H) mRNA, complete
tctgaggtggccagaatggatttgtg	U56417	Human lysophosphatidic acid acyltransferase-alpha mRNA, complete
gcgccgggccgggccatggagctgtg	U56418	Human lysophosphatidic acid acyltransferase-beta mRNA, complete
ctttctgtccccagcatgggcaccag	U56438	Human dioxin-inducible cytochrome P450 (CYP1B1) gene, complete cds.
tggtgtcctgtcaccatggcgctggc	U56602	Human peroxisome biogenesis disorder group 4 gene (PXAAA1) mRNA,
cgcctttcagtcaggatgtctgcccg	U56725	Human heat shock protein mRNA, complete cds.
cagagcagcgccaggatgtcacggga	U56814	Human DNase1-Like III protein (DNAS1L3) mRNA, complete cds.
tgggccaggccagtcatgctagaacg	U56816	Human kinase Myt1 (Myt1) mRNA, complete cds.
tcctgaaaaatcaaaatggatttaga	U56835	Human B-cell specific transcription factor (PAX-5) gene, exon 1A,
gtctggagcgccccgatggaaataca	U56836	Human B-cell specific transcription factor (PAX-5) gene, exon 1B,
ggccgcagaagcgagatgacgaaggg	U56856	Human ribosomal protein L37 (PSANK1) pseudogene.
agaccgtggctgagcatggagctgtc	U56976	Human calmodulin dependent phosphodiesterase PDE1B1 mRNA, complete
taaaagatccaaaaaatgagacttct	U56979	Human complement factor H precursor (Cfh) gene, partial cds.
ggacctgagctggagatgctggccgg	U56998	Human putative serine/threonine protein kinase PRK (prk) mRNA,
aacctggtgagccgcatgatctccga	AL021708	Homo sapiens partial cDNA homologous to M.musculus JIP-1 gene.
ggccttggcggggtcatggggccccc	U57001	Human ligand for eph-related receptor tyrosine kinases (EPLG8)
atgacatagagggagatgatgtgcga	U57029 M94653	Human T-cell leukemia virus enhancer factor (HTLF) mRNA, complete
ccgaccctcggctccatggagcccgg	U57052	Human Hoxb-13 mRNA, complete cds.
catgttaacaagcagatgtcatggca	U57057	Human WD protein IR10 mRNA, complete cds.
gactctgacaggatcatggctatgat	U57059	Homo sapiens Apo-2 ligand mRNA, complete cds.
ggctgcgagcacatgatggcgatacg	U57091	Human small GTP-binding protein rab22b mRNA, complete cds.
attgaagctgtgtaaatgagtatgga	U57092	Human small GTP-binding protein rab30.
accaagaccatcactatgaccgatgg	U57093	Homo sapiens small GTP-binding protein Rab27b mRNA, complete cds.
actgagttcttcattatgtctgatgg	U57094	Human small GTP-binding protein mRNA, complete cds.
ccgcgaacccccaccatgaagcccag	U57099	Human APEG-1 mRNA, complete cds.
ggcagattcctgtccatgctggagga	U57316	Human GCN5 (hGCN5) gene, complete cds.
gtgctccggggcggcatgtccgaggc	U57317	Homo sapiens p300/CBP-associated factor (P/CAF) mRNA, complete cds.
ggagctgagatcaggatgttccgctt	U57342	Human myelodysplasia/myeloid leukemia factor 2 (MLF2) mRNA,
ctgcacggggtcccgatggacctcaa	U57352	Human sodium channel 1 (hBNaC1) mRNA, complete cds.
actagtgctgtcattatgaatgtgac	U57456	Human transforming growth factor-beta signaling protein-1 (bsp-1)
catttggatctcagaatgagcaagga	U57592	Human jumonji putative protein (jumonji) mRNA, complete cds.
tagcccagcatcactatggtggacgc	U57623	Human fatty acid binding protein FABP gene, complete cds.
ccggaggccgcctggatggagccgcc	U57627	Human fetal brain oculocerebrorenal syndrome (OCRL1) mRNA, complete
cgtactgcccgtggcatgagggagcc	U57629	Human retinitis pigmentosa GTPase regulator (RPGR) mRNA, complete
cagtcgccaagaatcatgaaagtcgc	U57645	Human helix-loop-helix proteins Id-1 (ID-1) and Id-1' (ID-1) genes,
cgcctccgactcaaaatgcctgtctg	U57646	Homo sapiens cysteine and glycine-rich protein 2 (CSRP2) mRNA,
aggcccacgcccaccatggtcccctg	U57650	Human SH2-containing inositol 5-phosphatase (hSHIP) mRNA, complete
cctccacaaggctccatggccaatag	U57693	Human TFIID subunits TAF20 and TAF15 mRNA, complete cds.
agagaacaacttgtaatggagccttc	U57721	Human L-kynurenine hydrolase mRNA, complete cds.
gcttttcaggctctaatggctgaaga	U57796	Human zinc finger protein (LD5-1) mRNA, complete cds.
cccgggtggaacaagatggattatca	U57840	Human CC chemokine receptor 5 mRNA, complete cds.
aagtaacaacgcaggatgccccctgg	U57843	Human phosphatidylinositol 3-kinase delta catalytic subunit mRNA,
actccgctgctcgccatgtcttctca	U57846	Human ribosomal protein L39 mRNA, complete cds.
agaccggaacccaagatggctgcgct	U57877	Human integral membrane protein CII-3 mRNA, nuclear gene encoding
ctatagggaggaaggatggcacatgg	U57911	Human fetal brain (239FB) mRNA, from the WAGR region, complete cds.
ggcctgacaggcagcatgggcgacat	U57971	Human calcium ATPase isoform 3x/a mRNA, complete cds.
tgcccattccatgtcatgtatatctg	U58032	Homo sapiens myotubularin related protein 1 (MTMR1) mRNA, partial
gagcctgccgccaagatgccggccta	U58046	Human p167 mRNA, complete cds.
acggcgtgcgtcaccatggcgaccgc	U58048	Human metallopeptidase PRSM1 mRNA, complete cds.
agaacatccctcacaatgtcgtcaac	U58087	Human Hs-cul-1 mRNA, complete cds.
cctggaagcccgcgcatgcgccctga	U58096	Human testis-specific protein (TSPY) mRNA, complete cds.
cccggtccttccaccatgcacttgct	U58111	Human FLT4 ligand mRNA, complete cds.
aatcaattttggaagatgtcactgaa	U58130	Human bumetanide-sensitive Na-K-2Cl cotransporter (NKCC2) mRNA,
tccagatttagtaacatggcaaagtt	U58192	Human TFDP1P pseudogene, partial cds.
ccctcacgcaggcccatggcggcggc	U58196 S41456	Homo sapiens interleukin enhancer binding factor 1 mRNA, complete
ccctcacgcaggcccatggcggcggc	U58197 S41457	Homo sapiens interleukin enhancer binding factor 2 mRNA, complete
ccctcacgcaggcccatggcggcggc	U58198	Human interleukin enhancer binding factor 3 mRNA, complete cds.
agggaccaggtggagatgatgcctca	U58331	Human placental delta sarcoglycan mRNA, complete cds.
gttaatagtcctaggatggatctgac	U58334	Human Bcl2, p53 binding protein Bbp/53BP2 (BBP/53BP2) mRNA,
acttgaaagaagacgatgcatacagg	U58496	Human mnb protein kinase homolog hp86 (DYRK) mRNA, complete cds.
aagctggccaaggatatgggagcaac	U58514	Human chitinase precursor (HUMTCHIT) mRNA, exon 1a form, complete
ccgcgtccccgcagcatgccgcgccc	U58516	Human breast epithelial antigen BA46 mRNA, complete cds.
cctaaccgctccgtgatgcctaccaa	U58658	Human unknown protein mRNA within the p53 intron 1, complete cds.
gcgccctcaggcaccatgctgacccg	U58681	Homo sapiens neurogenic basic-helix-loop-helix protein (NeuroD2)
ccaggtgcaactgacatgggtgaacc	U58766	Human FX protein mRNA, complete cds.
cgcgtgccttggcccatggccgccta	U58773	Human calcium binding protein mRNA, complete cds.
taagcaggcatcaggatgttgggctg	U58837	Human cGMP-gated cation channel beta subunit (CNCG2) mRNA, complete
agagacaccaacaccatgttctgcac	U58855	Homo sapiens soluble guanylate cyclase large subunit (GC-S-alpha-1)
gaagaataagctaccatggcagctgt	U58856	Human chromosome 17 unknown product mRNA, complete cds.
ctgcccaccaggaggatgaaggtctc	U58913	Human chemokine (hmrp-2a) mRNA, complete cds.
ctgcccaccaggaggatgaaggtctc	U58914	Human chemokine (hmrp-2b) mRNA, complete cds.
gacgccacccgggccatgggggccgc	U58917	Homo sapiens IL-17 receptor mRNA, complete cds.
cggcctggccacgggatggcccccaa	U58970	Human putative outer mitochondrial membrane 34 kDa translocase
cggggctcctgcagcatggctgtcag	U58994	Human ladinin (LAD) gene, complete cds.
ctgccctggcctaagatgggccagtt	U58996	Homo sapiens testis calpastatin mRNA, complete cds.
cggaagcgggccacaatgaccctgca	U59057	Human beta-A4 crystallin (CRYBA4) mRNA, complete cds.
aggaaagcttgaaaaatgaagacatt	U59111	Human dermatan sulfate proteoglycan 3 (DSPG3) mRNA, complete cds.
gcggtgcagggtaacatggcggatgc	U59151	Human Cbf5p homolog (CBF5) mRNA, complete cds.
gcccgcgccgtcaccatgagccaggc	U59167	Human desmin mRNA, complete cds.
aatagaagaggcatcatgctgaagag	U59185	Human putative monocarboxylate transporter (MCT) mRNA, complete
ttgcataagaccaggatgtctctgaa	U59209	Homo sapiens C19steroid specific UDP-glucuronosyltransferase mRNA,
gtgtctccggaggccatgggctaccc	U59227	Human ectodermal dysplasia protein (EDA) gene, partial cds.
atgtctccggaggccatgggctaccc	U59228	Human ectodermal dysplasia protein (EDA) mRNA, complete cds.
gccagacccactgcgatgagacagca	U59269	Human hyaluronan synthase mRNA, complete cds.
ttctagtcggacaaaatgcagccgag	U59288	Human H-cadherin mRNA, complete cds.
ttctagtcggacaaaatgcagccgag	U59289	Human H-cadherin mRNA, complete cds.
aggcctcacccagcgatgcagaaagc	U59298	Human hox homeobox transcription factor (HOXB3) mRNA, complete cds.
cgtcagcagcagaggatgccccaggc	U59299	Homo sapiens putative monocarboxylate transporter MCT mRNA,
gtgaagtttttcaacatgagtggcct	U59302	Human steroid receptor coactivator-1 F-SRC-1 mRNA, complete cds.
gaaatcgaagcaaacatgtctggaga	U59305	Human ser-thr protein kinase PK428 mRNA, complete cds.
agctccctcagcaccatgtaccgagc	U59309	Human fumarase precursor (FH) mRNA, nuclear gene encoding
ctacccggaggcaccatgagcgtgga	U59323	Human homolog of yeast UPF1 (HUPF1) mRNA, complete cds.
gaaagttatcttacaatgaaaattac	U59325	Human cadherin-14 mRNA, complete cds.
actagtgctgtcattatgaatgtgac	U59423	Human Smad1 mRNA, complete cds.
tacaatcctgacacaatggaagtttc	U59431	Human truncated pancreatic polypeptide receptor PP2 mRNA, complete
ggtggtagtaggaagatgtcgggcga	U59435	Human cell cycle protein p38-2G4 homolog (hG4-1) mRNA, complete
ccgtagttgtcccaaatggagctgga	U59629	Homo sapiens transcription factor LZIP-alpha gene, complete cds.
tgccgtcttctcgccatgggctccgg	U59632	Homo sapiens H5 mRNA, partial cds; and platelet glycoprotein Ib