The Electronic Protocol Book
Common PCR and sequencing primers

Primer Name

Sequence

Melting Tm
(
AT=2,CG=4)

Melting Tm
Nearest Neighbor

KS

5- CGAGGTCGACGGTATCG

56 C

57 C

M13 (-20) (Universal)

5-GTAAAACGACGGCCAGT

52 C

55 C

M13 (-40)

5-GTTTTCCCAGTCACGAC

52 C

53 C

M13 forward

5'-GTTTTCCCAGTCACGACGTTG

64 C

59 C

M13 reverse

5'-TGAGCGGATAACAATTTCACACAG

68 C

58 C

M13 Reverse

5-CAGGAAACAGCTATGAC

50 C

50 C

M13 Reverse (-40)

5-GTTGTGTGGAATTGTG

46 C

48 C

Neomycin forward

5'-AGGATCTCCTGTCATCTCACCTTGCTCCTG

92 C

66 C

Neomycin reverse

5'-AAGAACTCGTCAAGAAGGCGATAGAAGGCG

90 C

65 C

SK

5- TCTAGAACTAGTGGATC

48 C

46 C

Sp6

5- CATACGATTTAGGTGACACTATAG

66 C

53 C

T3

5'-CGAAATTAACCCTCACTAAAGGGA

68 C

57 C

T3

5-ATTAACCCTCACTAAAG

46 C

45 C

T7

5'-GTAATACGACTACTATAGGG

56 C

48 C

T7 Reverse

5-GCTAGTTATTGCTCAGCGG

58 C

56 C

l gt11 Forward

5-GGTGGCGACGACTCCTGGAGCCCG

84 C

71 C

l gt11 Reverse

5-TTGACACCAGACCAACTGGTAATG

70 C

59 C

Table of Contents    <<  47  >>

Disclaim  ChangBioscience