LabLabel 1.02 is a label printing software (available for both Win/NT/XP 
and Mac OSX). In addition in printing conventional address, stock, and 
package labels, it can print eppendorf tube labels add barcodes to your 
labels. If your research is moving in the direction of high throughput, 
barcoding your reagents and data could result in enormous savings in time 
and money.

Usage:

1. Input
   Input label files should have either one of the following formats:
   (1) Tab delimited text files with individual labels in separate
   lines:
       If you edit you label information in Excel spreadsheet,
   you might want to save it as a "tab-delimited" text file. Each
   label will be in one line and each field will then be printed in
   a separated line. For example, the following stock label

   	5xTBA	Date: 3/21/2002	By: Eric Heller

   will be printed as

   	5xTBA
   	Date: 3/21/2002
   	By: Eric Heller

   (2) Text files with labels separated by a blank line:
       The software will print the following in two labels:

   	Name: P345
   	Sequence: ATCGGGTGTNNNCGCAGCGACC
   	Date: 2/11/2001
   	Scale: 40 nmol
   	Direction: forward

   	Name: P347
   	Sequence: TTTCGAGGCCAGCGTGCACC
   	Date: 2/11/2001
   	Scale: 40 nmol
   	Direction: reverse

2. Barcodes
   To include barcodes, check the Barcode checkbox on the toolbar
   menu. A randomly generated barcode will be included at the end
   of each label if you don't specify where or the code string.
   To insert barcode in the middle of a label, simply mark it with
   the word "barcode".

   	Name: P347
   	Sequence: TTTCGAGGCCAGCGTGCACC
   	barcode
   	Date: 2/11/2001
   	Scale: 40 nmol
   	Direction: reverse

   The above label will print a random barcode between "Sequence"
   and "Date" lines.

   To add a specific barcode, include the barcode string you want.

   	Name: P347
   	Sequence: TTTCGAGGCCAGCGTGCACC
   	barcode TTTCGAGG
   	Date: 2/11/2001
   	Scale: 40 nmol
   	Direction: reverse

   The above label will print a barcode encoded by the first 8
   nucleotide sequence of the primer.

   To print barcodes only, input as the following:

   	barcode

   	barcode

   	barcode

3. Barcode styles
   Code 39 and Code 128 are both alphanumeric barcodes of variable
   lengths. They are often the choices for internal tracking.
   Codebar is frequently used in blood banks.
   Contact us if you need other styles.
   For details, visit http://www.barcodehq.com/primer.html.

4. Label styles
   LabLabel 1.02 prints on 8.5x11 papers. Styles range from 80 labels
   per sheet (4x20) to 1 label per sheet (1x1). These styles are
   compatible with Avery label products.

   Style	Vendor/Avery ID
   4x20		8167, 5267
   7x17		divbio.com
   3x10		8160, 5360
   2x10		5161
   2x7		8162, 5162
   2x5		5963
   2x4		8163
   2x3		5164, 5264

   For details of supported Avery products, go to
   http://www.changbioscience.com/lablabel/index.html.

5. Preview will display the first page. Mouse-click will lead to
   additional pages if available.


Suggestions and Bug Reports

     Thanks for using LabLabel 1.02. Please let us know if you feel
there can be additional improvements in the software. Send your
comments, suggestions, and bugs to czhu@changbioscience.com.
We will try our best to serve your needs in the next release of
LabLabel.